ID: 1099990706

View in Genome Browser
Species Human (GRCh38)
Location 12:89718002-89718024
Sequence CCATGTGAGGACAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099990706_1099990713 1 Left 1099990706 12:89718002-89718024 CCTTCTGCCCTGTCCTCACATGG No data
Right 1099990713 12:89718026-89718048 CTTTCCTTGGTGCAAGTGCATGG No data
1099990706_1099990715 6 Left 1099990706 12:89718002-89718024 CCTTCTGCCCTGTCCTCACATGG No data
Right 1099990715 12:89718031-89718053 CTTGGTGCAAGTGCATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099990706 Original CRISPR CCATGTGAGGACAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr