ID: 1099995066

View in Genome Browser
Species Human (GRCh38)
Location 12:89769530-89769552
Sequence TCCTTTTGAGAAATACCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099995066_1099995067 -4 Left 1099995066 12:89769530-89769552 CCAAGAGGTATTTCTCAAAAGGA No data
Right 1099995067 12:89769549-89769571 AGGAGAGTAGTTATCTGAAGAGG No data
1099995066_1099995070 5 Left 1099995066 12:89769530-89769552 CCAAGAGGTATTTCTCAAAAGGA No data
Right 1099995070 12:89769558-89769580 GTTATCTGAAGAGGATGGCAGGG No data
1099995066_1099995068 0 Left 1099995066 12:89769530-89769552 CCAAGAGGTATTTCTCAAAAGGA No data
Right 1099995068 12:89769553-89769575 GAGTAGTTATCTGAAGAGGATGG No data
1099995066_1099995069 4 Left 1099995066 12:89769530-89769552 CCAAGAGGTATTTCTCAAAAGGA No data
Right 1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099995066 Original CRISPR TCCTTTTGAGAAATACCTCT TGG (reversed) Intergenic
No off target data available for this crispr