ID: 1099995070

View in Genome Browser
Species Human (GRCh38)
Location 12:89769558-89769580
Sequence GTTATCTGAAGAGGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099995064_1099995070 16 Left 1099995064 12:89769519-89769541 CCAGTAGTAGGCCAAGAGGTATT No data
Right 1099995070 12:89769558-89769580 GTTATCTGAAGAGGATGGCAGGG No data
1099995066_1099995070 5 Left 1099995066 12:89769530-89769552 CCAAGAGGTATTTCTCAAAAGGA No data
Right 1099995070 12:89769558-89769580 GTTATCTGAAGAGGATGGCAGGG No data
1099995063_1099995070 17 Left 1099995063 12:89769518-89769540 CCCAGTAGTAGGCCAAGAGGTAT No data
Right 1099995070 12:89769558-89769580 GTTATCTGAAGAGGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099995070 Original CRISPR GTTATCTGAAGAGGATGGCA GGG Intergenic
No off target data available for this crispr