ID: 1099996162

View in Genome Browser
Species Human (GRCh38)
Location 12:89781356-89781378
Sequence CTCTATACACAGACTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099996162_1099996167 17 Left 1099996162 12:89781356-89781378 CCCTTCTCAGTCTGTGTATAGAG No data
Right 1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099996162 Original CRISPR CTCTATACACAGACTGAGAA GGG (reversed) Intergenic
No off target data available for this crispr