ID: 1099996167

View in Genome Browser
Species Human (GRCh38)
Location 12:89781396-89781418
Sequence TTGCAGCAGCAGTGTCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099996161_1099996167 28 Left 1099996161 12:89781345-89781367 CCATTCAGCTGCCCTTCTCAGTC No data
Right 1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG No data
1099996166_1099996167 -9 Left 1099996166 12:89781382-89781404 CCAATGTGGAACACTTGCAGCAG No data
Right 1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG No data
1099996163_1099996167 16 Left 1099996163 12:89781357-89781379 CCTTCTCAGTCTGTGTATAGAGC No data
Right 1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG No data
1099996162_1099996167 17 Left 1099996162 12:89781356-89781378 CCCTTCTCAGTCTGTGTATAGAG No data
Right 1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099996167 Original CRISPR TTGCAGCAGCAGTGTCAGAT AGG Intergenic
No off target data available for this crispr