ID: 1100001583

View in Genome Browser
Species Human (GRCh38)
Location 12:89843434-89843456
Sequence CTGTAGCTGAGGAGGTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100001583_1100001590 22 Left 1100001583 12:89843434-89843456 CCTCCTCACCTCCTCAGCTACAG No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100001583 Original CRISPR CTGTAGCTGAGGAGGTGAGG AGG (reversed) Intergenic
No off target data available for this crispr