ID: 1100001590

View in Genome Browser
Species Human (GRCh38)
Location 12:89843479-89843501
Sequence CCCACTTATTCCTGTATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100001582_1100001590 29 Left 1100001582 12:89843427-89843449 CCTCTCACCTCCTCACCTCCTCA No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data
1100001586_1100001590 11 Left 1100001586 12:89843445-89843467 CCTCAGCTACAGTGACTTCTCTT No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data
1100001585_1100001590 14 Left 1100001585 12:89843442-89843464 CCTCCTCAGCTACAGTGACTTCT No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data
1100001581_1100001590 30 Left 1100001581 12:89843426-89843448 CCCTCTCACCTCCTCACCTCCTC No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data
1100001584_1100001590 19 Left 1100001584 12:89843437-89843459 CCTCACCTCCTCAGCTACAGTGA No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data
1100001583_1100001590 22 Left 1100001583 12:89843434-89843456 CCTCCTCACCTCCTCAGCTACAG No data
Right 1100001590 12:89843479-89843501 CCCACTTATTCCTGTATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100001590 Original CRISPR CCCACTTATTCCTGTATGCT TGG Intergenic
No off target data available for this crispr