ID: 1100004556 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:89878823-89878845 |
Sequence | CACTTCAGTGCTTCCTTCCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1100004556_1100004560 | 30 | Left | 1100004556 | 12:89878823-89878845 | CCTGGGAAGGAAGCACTGAAGTG | No data | ||
Right | 1100004560 | 12:89878876-89878898 | TCACACTTACTGAAAGTCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1100004556 | Original CRISPR | CACTTCAGTGCTTCCTTCCC AGG (reversed) | Intergenic | ||