ID: 1100004556

View in Genome Browser
Species Human (GRCh38)
Location 12:89878823-89878845
Sequence CACTTCAGTGCTTCCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100004556_1100004560 30 Left 1100004556 12:89878823-89878845 CCTGGGAAGGAAGCACTGAAGTG No data
Right 1100004560 12:89878876-89878898 TCACACTTACTGAAAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100004556 Original CRISPR CACTTCAGTGCTTCCTTCCC AGG (reversed) Intergenic
No off target data available for this crispr