ID: 1100004560

View in Genome Browser
Species Human (GRCh38)
Location 12:89878876-89878898
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100004557_1100004560 3 Left 1100004557 12:89878850-89878872 CCACCCTCACACACTTACACACA No data
Right 1100004560 12:89878876-89878898 TCACACTTACTGAAAGTCATTGG No data
1100004559_1100004560 -1 Left 1100004559 12:89878854-89878876 CCTCACACACTTACACACACACT No data
Right 1100004560 12:89878876-89878898 TCACACTTACTGAAAGTCATTGG No data
1100004556_1100004560 30 Left 1100004556 12:89878823-89878845 CCTGGGAAGGAAGCACTGAAGTG No data
Right 1100004560 12:89878876-89878898 TCACACTTACTGAAAGTCATTGG No data
1100004558_1100004560 0 Left 1100004558 12:89878853-89878875 CCCTCACACACTTACACACACAC No data
Right 1100004560 12:89878876-89878898 TCACACTTACTGAAAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100004560 Original CRISPR TCACACTTACTGAAAGTCAT TGG Intergenic