ID: 1100014028

View in Genome Browser
Species Human (GRCh38)
Location 12:89987234-89987256
Sequence GTGTGGGTATGGAGAGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100014021_1100014028 25 Left 1100014021 12:89987186-89987208 CCTGATGACAGTGCCTGTGAGTC No data
Right 1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG No data
1100014022_1100014028 12 Left 1100014022 12:89987199-89987221 CCTGTGAGTCCGCTAACATGCCA No data
Right 1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG No data
1100014026_1100014028 -8 Left 1100014026 12:89987219-89987241 CCATTCAGTTTTGTAGTGTGGGT No data
Right 1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG No data
1100014023_1100014028 3 Left 1100014023 12:89987208-89987230 CCGCTAACATGCCATTCAGTTTT No data
Right 1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100014028 Original CRISPR GTGTGGGTATGGAGAGACGA AGG Intergenic
No off target data available for this crispr