ID: 1100016535

View in Genome Browser
Species Human (GRCh38)
Location 12:90017267-90017289
Sequence AACCTATACCTGCCACAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100016535_1100016537 9 Left 1100016535 12:90017267-90017289 CCAATCTGTGGCAGGTATAGGTT No data
Right 1100016537 12:90017299-90017321 ATAGTAGCTTCCAGTTAGATGGG No data
1100016535_1100016541 19 Left 1100016535 12:90017267-90017289 CCAATCTGTGGCAGGTATAGGTT No data
Right 1100016541 12:90017309-90017331 CCAGTTAGATGGGGTGGCTATGG No data
1100016535_1100016539 13 Left 1100016535 12:90017267-90017289 CCAATCTGTGGCAGGTATAGGTT No data
Right 1100016539 12:90017303-90017325 TAGCTTCCAGTTAGATGGGGTGG No data
1100016535_1100016538 10 Left 1100016535 12:90017267-90017289 CCAATCTGTGGCAGGTATAGGTT No data
Right 1100016538 12:90017300-90017322 TAGTAGCTTCCAGTTAGATGGGG No data
1100016535_1100016536 8 Left 1100016535 12:90017267-90017289 CCAATCTGTGGCAGGTATAGGTT No data
Right 1100016536 12:90017298-90017320 TATAGTAGCTTCCAGTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100016535 Original CRISPR AACCTATACCTGCCACAGAT TGG (reversed) Intergenic
No off target data available for this crispr