ID: 1100018200

View in Genome Browser
Species Human (GRCh38)
Location 12:90037793-90037815
Sequence GATCATGTGTCCATATGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100018200_1100018201 -10 Left 1100018200 12:90037793-90037815 CCAATACATATGGACACATGATC No data
Right 1100018201 12:90037806-90037828 ACACATGATCAATTAAACTTTGG No data
1100018200_1100018203 22 Left 1100018200 12:90037793-90037815 CCAATACATATGGACACATGATC No data
Right 1100018203 12:90037838-90037860 CATTATTAATGAATCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100018200 Original CRISPR GATCATGTGTCCATATGTAT TGG (reversed) Intergenic
No off target data available for this crispr