ID: 1100019637

View in Genome Browser
Species Human (GRCh38)
Location 12:90053444-90053466
Sequence TGTGGACTAAATTAACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100019637_1100019640 -7 Left 1100019637 12:90053444-90053466 CCAGTCTGTTAATTTAGTCCACA No data
Right 1100019640 12:90053460-90053482 GTCCACACAGGGTTAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100019637 Original CRISPR TGTGGACTAAATTAACAGAC TGG (reversed) Intergenic
No off target data available for this crispr