ID: 1100019735 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:90055012-90055034 |
Sequence | TCACATAGCTGGGGGATTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1100019726_1100019735 | 17 | Left | 1100019726 | 12:90054972-90054994 | CCAACTTAAACTCTCTTAGGACA | No data | ||
Right | 1100019735 | 12:90055012-90055034 | TCACATAGCTGGGGGATTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1100019735 | Original CRISPR | TCACATAGCTGGGGGATTCA GGG | Intergenic | ||