ID: 1100019735

View in Genome Browser
Species Human (GRCh38)
Location 12:90055012-90055034
Sequence TCACATAGCTGGGGGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100019726_1100019735 17 Left 1100019726 12:90054972-90054994 CCAACTTAAACTCTCTTAGGACA No data
Right 1100019735 12:90055012-90055034 TCACATAGCTGGGGGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100019735 Original CRISPR TCACATAGCTGGGGGATTCA GGG Intergenic