ID: 1100020395

View in Genome Browser
Species Human (GRCh38)
Location 12:90062428-90062450
Sequence CTTTGCAATGCCAAGGCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100020390_1100020395 -8 Left 1100020390 12:90062413-90062435 CCTGTAATCCCAACACTTTGCAA 0: 35
1: 1508
2: 36271
3: 340089
4: 254166
Right 1100020395 12:90062428-90062450 CTTTGCAATGCCAAGGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100020395 Original CRISPR CTTTGCAATGCCAAGGCGGA CGG Intergenic
No off target data available for this crispr