ID: 1100020395 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:90062428-90062450 |
| Sequence | CTTTGCAATGCCAAGGCGGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100020390_1100020395 | -8 | Left | 1100020390 | 12:90062413-90062435 | CCTGTAATCCCAACACTTTGCAA | 0: 35 1: 1508 2: 36271 3: 340089 4: 254166 |
||
| Right | 1100020395 | 12:90062428-90062450 | CTTTGCAATGCCAAGGCGGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100020395 | Original CRISPR | CTTTGCAATGCCAAGGCGGA CGG | Intergenic | ||
| No off target data available for this crispr | |||||