ID: 1100023258

View in Genome Browser
Species Human (GRCh38)
Location 12:90097159-90097181
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100023258_1100023266 0 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023266 12:90097182-90097204 ACAGGTATCCTTCTAAGGGGGGG No data
1100023258_1100023263 -3 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023263 12:90097179-90097201 ATCACAGGTATCCTTCTAAGGGG No data
1100023258_1100023261 -5 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023261 12:90097177-90097199 CCATCACAGGTATCCTTCTAAGG No data
1100023258_1100023265 -1 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023265 12:90097181-90097203 CACAGGTATCCTTCTAAGGGGGG No data
1100023258_1100023264 -2 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023264 12:90097180-90097202 TCACAGGTATCCTTCTAAGGGGG No data
1100023258_1100023262 -4 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023262 12:90097178-90097200 CATCACAGGTATCCTTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100023258 Original CRISPR GATGGCATTTAACACCCATC TGG (reversed) Intergenic
No off target data available for this crispr