ID: 1100023261

View in Genome Browser
Species Human (GRCh38)
Location 12:90097177-90097199
Sequence CCATCACAGGTATCCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100023258_1100023261 -5 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023261 12:90097177-90097199 CCATCACAGGTATCCTTCTAAGG No data
1100023257_1100023261 5 Left 1100023257 12:90097149-90097171 CCTGGATCATCCAGATGGGTGTT No data
Right 1100023261 12:90097177-90097199 CCATCACAGGTATCCTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100023261 Original CRISPR CCATCACAGGTATCCTTCTA AGG Intergenic
No off target data available for this crispr