ID: 1100023265

View in Genome Browser
Species Human (GRCh38)
Location 12:90097181-90097203
Sequence CACAGGTATCCTTCTAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100023257_1100023265 9 Left 1100023257 12:90097149-90097171 CCTGGATCATCCAGATGGGTGTT No data
Right 1100023265 12:90097181-90097203 CACAGGTATCCTTCTAAGGGGGG No data
1100023258_1100023265 -1 Left 1100023258 12:90097159-90097181 CCAGATGGGTGTTAAATGCCATC No data
Right 1100023265 12:90097181-90097203 CACAGGTATCCTTCTAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100023265 Original CRISPR CACAGGTATCCTTCTAAGGG GGG Intergenic
No off target data available for this crispr