ID: 1100039164

View in Genome Browser
Species Human (GRCh38)
Location 12:90291453-90291475
Sequence CACCAAAGAGTGCAACTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100039164_1100039166 26 Left 1100039164 12:90291453-90291475 CCCTGTAGTTGCACTCTTTGGTG No data
Right 1100039166 12:90291502-90291524 TCAATGCTAGCCTGAATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100039164 Original CRISPR CACCAAAGAGTGCAACTACA GGG (reversed) Intergenic