ID: 1100039373

View in Genome Browser
Species Human (GRCh38)
Location 12:90295306-90295328
Sequence CTTTAGAAGCAGACAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100039373_1100039375 24 Left 1100039373 12:90295306-90295328 CCTTCCATTGTCTGCTTCTAAAG 0: 2
1: 0
2: 2
3: 25
4: 237
Right 1100039375 12:90295353-90295375 GCAGATGCAGATAAGAAACGTGG 0: 1
1: 1
2: 2
3: 8
4: 180
1100039373_1100039376 25 Left 1100039373 12:90295306-90295328 CCTTCCATTGTCTGCTTCTAAAG 0: 2
1: 0
2: 2
3: 25
4: 237
Right 1100039376 12:90295354-90295376 CAGATGCAGATAAGAAACGTGGG 0: 1
1: 1
2: 0
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100039373 Original CRISPR CTTTAGAAGCAGACAATGGA AGG (reversed) Intergenic
903255278 1:22093868-22093890 CTCTAGAAGTAGTCATTGGATGG + Intergenic
904473505 1:30750161-30750183 CTTTAGGAGCAGCCAGTGGGGGG + Intronic
904724237 1:32534763-32534785 CTTTAGAACTAGACAGTGGGTGG - Intronic
906137087 1:43507211-43507233 CTTCAGAAGCAAACCCTGGAAGG + Intergenic
906480673 1:46197354-46197376 CTCTAGAAACCAACAATGGAGGG - Intronic
906608723 1:47188016-47188038 CTTTAGAAGGGCAGAATGGAGGG + Intronic
908199703 1:61781624-61781646 CTTTAGAATCAGACAGATGAAGG + Intronic
908991832 1:70100686-70100708 CTTTAGAAACAGAAAATTTAAGG - Intronic
909055938 1:70821313-70821335 ATTTAGAAGCAGACCTTGAAAGG + Intergenic
910336459 1:86137585-86137607 CTTCAGAAGCAAATAAAGGAAGG - Intronic
911445176 1:97983769-97983791 CTTTAGAAACATACAAGGGATGG + Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
915148470 1:153809846-153809868 CTTTAGAAACACACATCGGAGGG + Exonic
917431966 1:174979309-174979331 CCTTTGAAGCAGACACTGGTTGG + Intronic
918184965 1:182119071-182119093 ATTTAGATTCAGACAATGGGAGG + Intergenic
919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG + Intronic
919543053 1:198875262-198875284 CTTCAGAAGAAAACAATGAATGG - Intergenic
920189790 1:204186285-204186307 CTTCAGATGCTGACATTGGAGGG - Intergenic
920447610 1:206030993-206031015 CTTTGGAAGCAGACAAAGCAAGG + Intergenic
922066905 1:222152976-222152998 CCTAAGAAGCAGACCATGCAAGG + Intergenic
922248076 1:223819705-223819727 CTGAGGAAGCACACAATGGATGG + Intronic
922907547 1:229185863-229185885 GTTAAGAAGCAGACACTGGATGG + Intergenic
923505977 1:234607593-234607615 TCTTAGTAGCAGACAATGCAGGG - Exonic
1063088022 10:2837009-2837031 CTTGAGAAGCAGACAAGAGTCGG - Intergenic
1066762115 10:38765052-38765074 CTTCAGAAACAAGCAATGGAGGG + Intergenic
1068033990 10:51737309-51737331 CTTTAGAATCATACCATGAACGG - Intronic
1069519292 10:69105717-69105739 CTTTTGAAAAAGACAATGAAAGG + Intergenic
1070669082 10:78365472-78365494 CTTTAGAACCAGGAAAAGGAGGG + Intergenic
1071201513 10:83223968-83223990 CTTTATGGGCACACAATGGAGGG + Intergenic
1073885925 10:108039621-108039643 CTTTAAAAGCAGATTATTGATGG + Intergenic
1078273529 11:9820284-9820306 CTTTGGAAGCAGAAAATGAAGGG + Intronic
1078319249 11:10318942-10318964 CTTTATAAGAAGACTATGGGAGG + Intronic
1080883867 11:36347768-36347790 CTTTAGAAGGAGGCTATGTAAGG - Intronic
1081625226 11:44651462-44651484 CAGAAGAAGCAGACAATGGTGGG + Intergenic
1082708641 11:56525690-56525712 CTCTGGAAGCAGACAAAGAATGG - Intergenic
1082987953 11:59184118-59184140 ATTTGGGAGCAGAGAATGGATGG + Intronic
1084353589 11:68622184-68622206 CTATAGAGACAGACAATAGAGGG + Intergenic
1086912710 11:92491504-92491526 TTCTCCAAGCAGACAATGGAAGG + Intronic
1087238837 11:95752523-95752545 CTATAGGAGCTGAGAATGGATGG + Intergenic
1089406094 11:118198749-118198771 CTTTAAAAGCAGAAAATACAAGG - Intronic
1089712569 11:120325997-120326019 CTTTAGAAGGAGATAAGGGAGGG + Intronic
1090213553 11:124940476-124940498 GTTTTGAAGAAGACAAAGGAGGG - Intergenic
1092548391 12:9471342-9471364 CTTCAGAAGCACACAATGTCAGG + Intergenic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1094504610 12:31051107-31051129 CTTCAGAAGCACACAATGTCAGG - Intergenic
1096299709 12:50416062-50416084 CTTTGAAAGTACACAATGGAAGG + Intronic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1097026199 12:56057492-56057514 CTCTAGAAGCTGAAAAGGGAAGG - Intergenic
1097648764 12:62268702-62268724 TTTTAAAAGCAAAGAATGGAGGG - Intronic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1100121107 12:91370431-91370453 ATTTAGAATCAGTCAATGGGAGG - Intergenic
1100222297 12:92518465-92518487 CTTTAAAAGAAGGCAATGAAGGG - Intergenic
1100420253 12:94425297-94425319 ATTAAGAAGCAGACATTGCATGG + Intronic
1101568823 12:105934644-105934666 CTTGAGAAGCAGGCAAGGGAGGG + Intergenic
1103018592 12:117515357-117515379 GTGTAGCAGCAGACAATGAATGG - Intronic
1105264823 13:18806470-18806492 CTTTGGAACCAGGTAATGGATGG - Intergenic
1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG + Intergenic
1108368519 13:49743088-49743110 CTTTAGAAGCTTACAATCTAAGG + Intronic
1108462873 13:50684644-50684666 CTGTATAGCCAGACAATGGAAGG - Intronic
1108809037 13:54197915-54197937 TTTTAGATGCAAGCAATGGAAGG - Intergenic
1109711669 13:66168639-66168661 CTTTAGAAGCAGAAAAGGAAAGG - Intergenic
1112126688 13:96476273-96476295 CTTTAGACACGTACAATGGATGG + Intronic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1115683298 14:35766096-35766118 CTTTAGGATCAGATACTGGAGGG + Intronic
1117179707 14:53179806-53179828 CTTCAGAACAAGACAATAGATGG - Intergenic
1117542473 14:56761754-56761776 CTTTAGAAGCAGGCGATGAATGG - Intergenic
1118007551 14:61577204-61577226 CTTTCCCAGCAGACAATGGTGGG - Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1118918822 14:70131358-70131380 CTTTAGAATCAGACAAGGTTTGG + Intronic
1119130310 14:72166587-72166609 CTTTAGAAATAGACCAAGGATGG + Intronic
1119597898 14:75953521-75953543 TTTTAAAAGCAAACAAGGGAAGG + Intronic
1121842682 14:97147591-97147613 CTCTAGAAGCTGAAAAAGGAAGG - Intergenic
1121882660 14:97514719-97514741 CTTTGGGAGGAGACATTGGAAGG + Intergenic
1202833643 14_GL000009v2_random:61647-61669 CTTTGGAACCAGGTAATGGACGG + Intergenic
1123824989 15:24072223-24072245 CTCTAGAAGCAGGAAATGCAGGG + Intergenic
1123962163 15:25415038-25415060 CTTTAGAATCAGACAAATTAGGG - Intronic
1124057560 15:26256034-26256056 CTTGGGAAGAAGACCATGGAGGG + Intergenic
1124160194 15:27261199-27261221 CTCTAGAAGAAGAAAATGGTTGG + Intronic
1125106014 15:35972162-35972184 CTATAGAAGAAGCCAATGGGAGG + Intergenic
1127771045 15:62230972-62230994 CTCTTGAAGCTGACAATGGAGGG - Intergenic
1128692697 15:69737329-69737351 TTTTAGAAGCAGAGATTAGAGGG + Intergenic
1133663203 16:7939100-7939122 CTTCAGTAGCAGAGGATGGAAGG + Intergenic
1135008734 16:18853900-18853922 CTTTAAAAGCAAATGATGGAGGG + Intronic
1135530733 16:23251187-23251209 CTTTCAAAGCACACGATGGAGGG - Intergenic
1137788987 16:51158573-51158595 TTTATGAAGCAGAAAATGGAGGG - Intergenic
1140167071 16:72563717-72563739 CTTAAGAAGCATAAAATGTAGGG + Intergenic
1140181666 16:72726046-72726068 CTTTGGAATCAGACAATGCTGGG + Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1143787838 17:9269492-9269514 CACTAGCAGCAGACATTGGAAGG - Intronic
1143858421 17:9869947-9869969 CTTTAAAGGCTGACAATGGAGGG + Intronic
1144046437 17:11458570-11458592 CTATGGATGCAGACAATTGATGG + Intronic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1149160756 17:53689800-53689822 CTATAGAAACAGACTATGGTAGG - Intergenic
1150135852 17:62694599-62694621 GTTGAGAAATAGACAATGGATGG + Intergenic
1152992376 18:375208-375230 CTTTGGAGGCAGACAGTGTAGGG - Intronic
1153369378 18:4296877-4296899 CTTTCTGAGCAGGCAATGGATGG + Intronic
1153558884 18:6349818-6349840 CTTTGGGAGCAGTCACTGGAAGG + Intronic
1154423574 18:14255080-14255102 CTTTGGAACCAGGTAATGGATGG + Intergenic
1155984264 18:32213330-32213352 CTTTAGAAGAGTAAAATGGAGGG - Exonic
1159190062 18:65029711-65029733 ATTTTGAAGCAGATCATGGAGGG - Intergenic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1161442304 19:4298980-4299002 CTTCAGAAGCTGACAATCTAGGG + Intronic
1165070822 19:33253948-33253970 CATTAGGTGCAGACAATGAAAGG - Intergenic
1202639027 1_KI270706v1_random:66045-66067 CTTTGGAACCAGGTAATGGACGG - Intergenic
926463056 2:13157534-13157556 CTCTAGAAGCTGAAAATGCAAGG - Intergenic
926817940 2:16819151-16819173 CTTTATAAGCAGAGAAAGGCTGG - Intergenic
927411163 2:22828032-22828054 CTTCACAAGCAGCAAATGGAAGG + Intergenic
927883103 2:26702645-26702667 GTATACAAGCAGACACTGGATGG + Intronic
928835883 2:35544493-35544515 CTATAAAAGCAAACACTGGAAGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929821336 2:45276424-45276446 CTCTGGAATCAGAAAATGGAAGG + Intergenic
929903023 2:46022304-46022326 CTTTAGAATCAGATTCTGGAGGG - Intronic
933030748 2:77325841-77325863 CTTCAGAAGCAAACTATGAATGG - Intronic
933281641 2:80338320-80338342 CTTTTAAAGCAGATAATGGGAGG + Intronic
933331081 2:80893901-80893923 CTTTGCAAACAGAGAATGGAGGG + Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
938639945 2:133267165-133267187 CGTTAGGGGCAGACAATAGAAGG - Intronic
939047406 2:137266001-137266023 ATCTAGGAGCAGACAATGAATGG - Intronic
939098400 2:137864032-137864054 CTTTAGCTGCAGTCAATGAAAGG + Intergenic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939172672 2:138713380-138713402 CTTTAGAAGCTTCCAAAGGAAGG + Intronic
939656998 2:144838214-144838236 CTTTAGAAGCAGATTAAGGTAGG + Intergenic
940027454 2:149223606-149223628 CTTGAGAAGCAGGCAAAAGAAGG - Intergenic
941513987 2:166449209-166449231 TTTTAGAACCAGACAATGGATGG + Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942881103 2:180861437-180861459 CTTTAGAAAAAAACAATGCATGG + Intergenic
942887915 2:180951117-180951139 TTCTAGAAGAAGAGAATGGAGGG - Intergenic
945011578 2:205469530-205469552 CTTCTGAAGCAGAGACTGGATGG - Intronic
945112936 2:206380698-206380720 CTTTTAAAGAAGACAATGGAAGG - Intergenic
947838254 2:233190329-233190351 CTTGAGAAGCAGAGAAGGGCAGG - Intronic
947969197 2:234307836-234307858 CCTGAGAAGCAGGCAATGAAAGG - Intergenic
948635022 2:239329281-239329303 TTTTACTAGCAGATAATGGAGGG - Intronic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169060196 20:2655446-2655468 CTGGAGGAGCTGACAATGGATGG + Exonic
1169070731 20:2728341-2728363 CTTTAGAATCAGACAATCTCTGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171367110 20:24632788-24632810 CTTTACAAGGAAACAAGGGAAGG + Intronic
1171885635 20:30650232-30650254 CTTTGGAACCAGGTAATGGAAGG - Intergenic
1172949405 20:38713089-38713111 CTTTAGAGGCAGTCGATGGAAGG + Intergenic
1174433530 20:50488930-50488952 CTTTAGAAGCTGGAAATGGCAGG - Intergenic
1176849901 21:13904927-13904949 CTTTGGAACCAGGTAATGGATGG - Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1178075117 21:29008456-29008478 ATTGAAAAGAAGACAATGGAGGG - Exonic
1178441204 21:32599831-32599853 CTTTTGAGGCAGACAAGGGCAGG + Intronic
1179042436 21:37815940-37815962 CTTCTGAAGCAGACAGTAGAGGG + Intronic
1180362921 22:11915818-11915840 CTTTGGAACCAGGTAATGGACGG + Intergenic
1181544421 22:23593270-23593292 CAGTAGAAGAAGTCAATGGAAGG + Intergenic
1181741692 22:24926154-24926176 CTTTACAAGCACACAAGGCAAGG - Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183248460 22:36711523-36711545 CTTTAGGAGAAGACAATGGGTGG + Intergenic
1184991791 22:48175242-48175264 CTATAGAAAAAAACAATGGAGGG + Intergenic
949399859 3:3654777-3654799 CTTGAGAAGCAGAAAACGAATGG + Intergenic
950350594 3:12347376-12347398 CCATAAAAGCAGACAAAGGAAGG - Intronic
951051369 3:18097657-18097679 CTCTAGAAGCAGGAAATGGCAGG - Intronic
951569346 3:24045851-24045873 CTTAAGAAGCAGAAAATTAAGGG - Intergenic
953833656 3:46324766-46324788 GTTTGGAAGAAGACAATGGCAGG + Intergenic
955049546 3:55396681-55396703 CTTAAAAAGCAAACAATGTAAGG - Intergenic
957411978 3:79853104-79853126 ATTTAGAAACAGAGAATGGAAGG - Intergenic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
958898372 3:99856055-99856077 GTTCAGAACCAAACAATGGATGG - Intronic
959603307 3:108213415-108213437 CTTTAGCTGCACACTATGGATGG + Intronic
959926438 3:111926690-111926712 CTTCAGAGGCAGAGAATGGTTGG + Intronic
960757120 3:121027509-121027531 CTTTAGAAGCTGAAAAAGGAAGG - Intronic
963033319 3:141000540-141000562 CTTTAGCAGCACACAAAGAAGGG - Intergenic
963066764 3:141270369-141270391 CTTTAAAAGCAGACGATGAGAGG + Intronic
963073952 3:141329175-141329197 CTTAAGAAGCATATAAAGGATGG - Intronic
965534325 3:169809438-169809460 CTTTAGAAAGAGGAAATGGAAGG - Intronic
967223067 3:187265525-187265547 TTTTAGAAGCAGAGAAGAGAAGG + Intronic
967612235 3:191521000-191521022 TTCTAGAAGAAGAAAATGGAAGG + Intergenic
967731066 3:192907387-192907409 CTATAGTCGCAGACAAGGGAGGG - Intronic
968153179 3:196355816-196355838 CTGCAGACTCAGACAATGGAGGG + Exonic
969895949 4:10304827-10304849 CTTTAGAAGTAAAAAATTGAAGG - Intergenic
970246762 4:14072267-14072289 ATATACAAGCAGACAATGAATGG + Intergenic
972373789 4:38451078-38451100 CTTTAGAAACAGATAAAAGAAGG + Intergenic
977377382 4:96223193-96223215 CAATAGAAGCAGATTATGGATGG - Intergenic
979409193 4:120353860-120353882 CTTGAGAAACAGACATAGGAAGG - Intergenic
980802414 4:137769403-137769425 CCTTAGAAGAAGACTATCGAAGG + Intergenic
983089210 4:163484664-163484686 CTGTAGAAGAATACAATGAAAGG + Intergenic
983163066 4:164441177-164441199 CTTTAGAATCAGTCATTGCATGG - Intergenic
984074886 4:175164031-175164053 CTTTAGGGGCAAAAAATGGATGG + Intergenic
1202766376 4_GL000008v2_random:151903-151925 CTTTGGAACCAGGTAATGGATGG - Intergenic
987359611 5:17095056-17095078 CTTTAGAATCATGCAATAGAAGG + Intronic
987837838 5:23184642-23184664 CTTTAGAAGCAAGAATTGGAAGG - Intergenic
991178364 5:63718331-63718353 GTTTAGTTGCAGAAAATGGATGG + Intergenic
993914079 5:93720252-93720274 CTTTTGAAGCAGTCAAATGAAGG - Intronic
997606141 5:135176993-135177015 CTGAAGAAGCAGGGAATGGAGGG + Intronic
999071873 5:148752027-148752049 TCTTAGAAGCAGACAATGAATGG - Intergenic
1000723876 5:164743820-164743842 TTTTTGAAGCAAACAAAGGAAGG + Intergenic
1000927204 5:167208362-167208384 CTTTAGAAGCATAGAGTGAAAGG + Intergenic
1001849208 5:174949020-174949042 CTTTAGAATCAGACAAATGCAGG - Intergenic
1003666227 6:8114169-8114191 CATAAGAAGCAGACAATGGCCGG - Intergenic
1003953190 6:11138276-11138298 CTTTAGAAGCAGACAATACAAGG - Exonic
1004202272 6:13560120-13560142 ATTAAGAAGCAGACAATGCATGG + Intergenic
1005397554 6:25398853-25398875 CTTTTGAAGCTGATAATTGAGGG + Intronic
1006171925 6:32098002-32098024 CTTTACGAGCACACAGTGGAAGG - Intronic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1010132445 6:72510148-72510170 GGTTAGAAGCAGCCAATGCAAGG - Intergenic
1011378810 6:86720232-86720254 CTGTAGAAGCAGACAATGACTGG + Intergenic
1011517968 6:88173109-88173131 CTCTAGAAGGTGACAAAGGAGGG - Intergenic
1012228252 6:96729897-96729919 CTCTAGAAGCAGAAAAGGCAAGG + Intergenic
1014374935 6:120660568-120660590 CTTCACCAGCACACAATGGAAGG - Intergenic
1014446726 6:121536584-121536606 TTTTAGAAGCATTCAATTGAGGG - Intergenic
1016871986 6:148826774-148826796 CTTTAGAAGCTGAAAAGGCAAGG - Intronic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1021665028 7:22968685-22968707 CACTAAAAGCAGACAATGTAAGG + Intronic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1024157040 7:46636526-46636548 CTATAGAAGCAGAGAATTGGAGG - Intergenic
1024535523 7:50428006-50428028 CTTTGGAAGCAGGCCATGGTCGG - Intergenic
1026554811 7:71398534-71398556 TTTTAGAAACAGACTATGCAGGG - Intronic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1027157066 7:75775953-75775975 CTTTATAAGAAGGCCATGGAGGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1030062699 7:105635462-105635484 CATAAGAAGCAGTCCATGGATGG - Intronic
1031262741 7:119543033-119543055 CTGTAGAAGAAGCCCATGGATGG + Intergenic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1031791610 7:126113132-126113154 CTTCAGAAGATGACAGTGGAAGG - Intergenic
1031847005 7:126817696-126817718 TTTCAGAAGCAGACATTTGAGGG + Intronic
1037691671 8:21186153-21186175 CTTTATCAGCAGACAAGGAAAGG + Intergenic
1038808382 8:30814801-30814823 CTTTCCAAACAGACAATGAATGG - Intergenic
1039611762 8:38924664-38924686 CTGTAGATGCAGGCCATGGAAGG + Intronic
1039938485 8:42068544-42068566 CTCTAGAGGCAGACAATGCCAGG - Intergenic
1040448056 8:47516103-47516125 CTTAAAAAGCAGACACTGGCCGG - Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044869371 8:96603528-96603550 CTTTAGCAGCAGACAGGGTATGG + Intronic
1045418275 8:101988679-101988701 CATTAGAAGCAGACAAGGATAGG - Intronic
1046539410 8:115559846-115559868 CTTCAATAACAGACAATGGATGG + Intronic
1046727472 8:117691049-117691071 GGTTTGAAGCAGACGATGGATGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1052190751 9:25658682-25658704 GTTAAGAAGCAGACACTGTAGGG + Intergenic
1052261945 9:26526926-26526948 CTTTCCAAGCTGACAAGGGAAGG + Intergenic
1052641410 9:31170445-31170467 CTTTAAAAGCGGACAAAGCAAGG - Intergenic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1055842404 9:80520468-80520490 CTTGAGAAGCTGAAAATGCAAGG + Intergenic
1055961635 9:81826100-81826122 CTTGAGAGGCACAGAATGGAAGG + Intergenic
1056315289 9:85382748-85382770 CTTTAGAAGATCACACTGGATGG - Intergenic
1058985906 9:110208077-110208099 CTTTAGGATCAAGCAATGGAAGG - Exonic
1060032961 9:120231587-120231609 ATTATGAAGCAGACATTGGAAGG + Intergenic
1062339547 9:136087877-136087899 CTTGGGCAGCAGACAAGGGACGG - Intronic
1203547132 Un_KI270743v1:136793-136815 CTTTGGAACCAGGTAATGGACGG - Intergenic
1185509649 X:653810-653832 GTTTAATAGCAGACAATGTAGGG + Intronic
1186145360 X:6619149-6619171 ATTAAGAAGCAGACACTGCATGG + Intergenic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1186715970 X:12251681-12251703 CTCTAGAAGCAGACACTGAAAGG - Intronic
1187476033 X:19611754-19611776 CTTAAGAAGCAGAATATAGATGG - Intronic
1188461994 X:30438584-30438606 GTTTTGATGCAGAAAATGGAAGG - Intergenic
1189299769 X:39944047-39944069 TTCTAGAAGGAGACACTGGAGGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192370879 X:70512011-70512033 GGTTGGAAGCAGACTATGGAGGG - Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1194715173 X:97279616-97279638 TTTTAGAAACAGAGACTGGATGG - Intronic
1195756768 X:108206302-108206324 CTTTAGAGGCACAGATTGGATGG + Intronic
1196065708 X:111462020-111462042 CTCTAGAAGCTGAAAATGGAAGG - Intergenic
1198613198 X:138425031-138425053 CTTCAGATTCAGTCAATGGAAGG - Intergenic
1200683141 Y:6236280-6236302 CTTTAGAAGCAGAGACTGAAAGG - Intergenic
1201049491 Y:9918106-9918128 CTTTAGAAGCAGAGACTGAAAGG + Intergenic
1201940929 Y:19459063-19459085 CATTAGAACCAGATAATGGAGGG - Intergenic