ID: 1100047075

View in Genome Browser
Species Human (GRCh38)
Location 12:90395694-90395716
Sequence GGATTCCAAGTAAAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100047071_1100047075 2 Left 1100047071 12:90395669-90395691 CCTAGATTAATATAAAACCCGGA No data
Right 1100047075 12:90395694-90395716 GGATTCCAAGTAAAAGAAGCAGG No data
1100047069_1100047075 22 Left 1100047069 12:90395649-90395671 CCAATTGAGAACTTACAGAACCT No data
Right 1100047075 12:90395694-90395716 GGATTCCAAGTAAAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100047075 Original CRISPR GGATTCCAAGTAAAAGAAGC AGG Intergenic