ID: 1100055028

View in Genome Browser
Species Human (GRCh38)
Location 12:90498570-90498592
Sequence ATCTATAAATTAGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100055028_1100055033 27 Left 1100055028 12:90498570-90498592 CCTTCCATCTCTAATTTATAGAT No data
Right 1100055033 12:90498620-90498642 CTTGAATGTCAATATGTTAAAGG No data
1100055028_1100055031 -1 Left 1100055028 12:90498570-90498592 CCTTCCATCTCTAATTTATAGAT No data
Right 1100055031 12:90498592-90498614 TAGTAAAATCTATGATATGGTGG No data
1100055028_1100055032 0 Left 1100055028 12:90498570-90498592 CCTTCCATCTCTAATTTATAGAT No data
Right 1100055032 12:90498593-90498615 AGTAAAATCTATGATATGGTGGG No data
1100055028_1100055030 -4 Left 1100055028 12:90498570-90498592 CCTTCCATCTCTAATTTATAGAT No data
Right 1100055030 12:90498589-90498611 AGATAGTAAAATCTATGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100055028 Original CRISPR ATCTATAAATTAGAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr