ID: 1100060208

View in Genome Browser
Species Human (GRCh38)
Location 12:90566074-90566096
Sequence GGGCATGCTGATGCAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100060202_1100060208 2 Left 1100060202 12:90566049-90566071 CCTTTGACTCCATGTCTCACCTC No data
Right 1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG No data
1100060201_1100060208 24 Left 1100060201 12:90566027-90566049 CCTTAAAGTTTCAAAATGATCTC No data
Right 1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG No data
1100060205_1100060208 -7 Left 1100060205 12:90566058-90566080 CCATGTCTCACCTCCAGGGCATG No data
Right 1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100060208 Original CRISPR GGGCATGCTGATGCAAAATG TGG Intergenic
No off target data available for this crispr