ID: 1100074255

View in Genome Browser
Species Human (GRCh38)
Location 12:90759551-90759573
Sequence GTCCATACACCTGGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100074255_1100074257 7 Left 1100074255 12:90759551-90759573 CCAACAACACCAGGTGTATGGAC No data
Right 1100074257 12:90759581-90759603 TTTCAATCTAGTAAGTAGAGAGG No data
1100074255_1100074258 22 Left 1100074255 12:90759551-90759573 CCAACAACACCAGGTGTATGGAC No data
Right 1100074258 12:90759596-90759618 TAGAGAGGAAGCACAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100074255 Original CRISPR GTCCATACACCTGGTGTTGT TGG (reversed) Intergenic
No off target data available for this crispr