ID: 1100076061

View in Genome Browser
Species Human (GRCh38)
Location 12:90785368-90785390
Sequence TTGACCTTGAATAGAAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100076061_1100076065 5 Left 1100076061 12:90785368-90785390 CCCCAACTTCTATTCAAGGTCAA No data
Right 1100076065 12:90785396-90785418 AAGTCCTAGCCAAAGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100076061 Original CRISPR TTGACCTTGAATAGAAGTTG GGG (reversed) Intergenic
No off target data available for this crispr