ID: 1100079097

View in Genome Browser
Species Human (GRCh38)
Location 12:90825881-90825903
Sequence GCTTATGGAGGCCATCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100079097_1100079101 -5 Left 1100079097 12:90825881-90825903 CCAGAATGATGGCCTCCATAAGC No data
Right 1100079101 12:90825899-90825921 TAAGCTGTCACTGAAAGGCCTGG No data
1100079097_1100079099 -10 Left 1100079097 12:90825881-90825903 CCAGAATGATGGCCTCCATAAGC No data
Right 1100079099 12:90825894-90825916 CTCCATAAGCTGTCACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100079097 Original CRISPR GCTTATGGAGGCCATCATTC TGG (reversed) Intergenic
No off target data available for this crispr