ID: 1100080685

View in Genome Browser
Species Human (GRCh38)
Location 12:90846442-90846464
Sequence GAGAAACAACAGAAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100080685_1100080689 10 Left 1100080685 12:90846442-90846464 CCCCACAACTTCTGTTGTTTCTC No data
Right 1100080689 12:90846475-90846497 TGAGCATTTTTTATTTCAACTGG No data
1100080685_1100080690 11 Left 1100080685 12:90846442-90846464 CCCCACAACTTCTGTTGTTTCTC No data
Right 1100080690 12:90846476-90846498 GAGCATTTTTTATTTCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100080685 Original CRISPR GAGAAACAACAGAAGTTGTG GGG (reversed) Intergenic
No off target data available for this crispr