ID: 1100083305

View in Genome Browser
Species Human (GRCh38)
Location 12:90878224-90878246
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100083302_1100083305 16 Left 1100083302 12:90878185-90878207 CCTGACATCTTCTGCAGATAACT No data
Right 1100083305 12:90878224-90878246 ACAGCTCTTTGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100083305 Original CRISPR ACAGCTCTTTGCCTGTTACT GGG Intergenic
No off target data available for this crispr