ID: 1100085927

View in Genome Browser
Species Human (GRCh38)
Location 12:90910727-90910749
Sequence TGTAATGTGATATCACCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100085927_1100085929 16 Left 1100085927 12:90910727-90910749 CCATAAGGTGATATCACATTACA 0: 1
1: 0
2: 1
3: 34
4: 395
Right 1100085929 12:90910766-90910788 AAAAAAAAAAAAACATACACTGG 0: 1
1: 52
2: 734
3: 9298
4: 88754
1100085927_1100085930 21 Left 1100085927 12:90910727-90910749 CCATAAGGTGATATCACATTACA 0: 1
1: 0
2: 1
3: 34
4: 395
Right 1100085930 12:90910771-90910793 AAAAAAAACATACACTGGCGAGG 0: 1
1: 0
2: 4
3: 203
4: 2676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100085927 Original CRISPR TGTAATGTGATATCACCTTA TGG (reversed) Intronic
902544467 1:17180695-17180717 AGTAAGGTGATATCACATTGTGG - Intergenic
904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG + Intronic
904816366 1:33203671-33203693 TGTGAGGTGATATCTCCTTGTGG + Intergenic
905248806 1:36633951-36633973 TGTAAAGTGATATCTCATTATGG + Intergenic
905982825 1:42246470-42246492 TGTAAGAGGATATCACCTTCTGG - Intronic
906053515 1:42894973-42894995 AGTAGGGTGATATCACCTTGTGG + Intergenic
906182157 1:43831164-43831186 TGTAAAGTGTAATCAGCTTAAGG - Intronic
906920508 1:50059479-50059501 TGTAAAGTGGTATCTCATTATGG - Intronic
907583265 1:55591257-55591279 TGTGAGGTGATATCTCATTATGG + Intergenic
909150286 1:71994199-71994221 TTTAATGTCTTATCACCTTTAGG - Intronic
909312218 1:74166891-74166913 AGTAAGGTGATATCACCTTGTGG - Intronic
910180142 1:84473759-84473781 TGTAAGGTGATATCTCATTGTGG + Intergenic
910611382 1:89146732-89146754 TGTGAGGTGATATCTCATTATGG - Intronic
911530178 1:99035024-99035046 TGTGATGTGATATATCCTTGGGG - Intergenic
911921710 1:103771486-103771508 TGTAATGTGACATCTCATTATGG - Intergenic
912663415 1:111556208-111556230 TGTAAAGTGATATCTCATTGTGG - Intronic
912962020 1:114204499-114204521 TGTAAGGTGATATCACATTGTGG - Intergenic
913458087 1:119054335-119054357 TATAAGGTGATATCACATTATGG - Intronic
915182339 1:154073212-154073234 AGTAAGGTGATATCACATTGTGG - Intronic
915547170 1:156606848-156606870 GGTAATCAGATATCACCTGATGG - Intergenic
915787531 1:158631737-158631759 TGTGAAGTGATATCTCATTATGG - Intronic
916147849 1:161757203-161757225 TGGAATGTTATATGATCTTAAGG + Intronic
916251742 1:162745041-162745063 TATAAGGTGATATCTCATTATGG + Intronic
916325437 1:163553844-163553866 TGTGAAGTGTTATCACCTGAAGG - Intergenic
916521261 1:165565485-165565507 TGTAATGTGAGATAACGTTAGGG - Intergenic
916546096 1:165805897-165805919 TGTAAGGTGATATCTCATTGTGG - Intronic
916867146 1:168872430-168872452 TGTGAAGTGATATCTCCTTGTGG - Intergenic
918699682 1:187592215-187592237 TATAATGAGATACCACCTTTAGG - Intergenic
918843031 1:189569108-189569130 TGTAAGGTGATATCTCATTGTGG - Intergenic
918843126 1:189570679-189570701 TGTAAGGTGATATCTCATTGTGG - Intergenic
919139142 1:193548522-193548544 TGTCATGTGATAACCACTTATGG - Intergenic
920091866 1:203459800-203459822 TGTGAGGTGATATCTCCTTGTGG - Intergenic
920235647 1:204502240-204502262 TGTGAGGTGATATCTCGTTATGG - Intergenic
921427895 1:215025552-215025574 TATAATGTGACATAAACTTAGGG - Intronic
921783820 1:219202060-219202082 TGTTATATGATGTCAGCTTAAGG - Intronic
923252007 1:232186237-232186259 GGTGACGTGATATCACCTTTGGG + Intergenic
923511050 1:234653954-234653976 TGTCAGGTGATATCACATTGTGG - Intergenic
924320678 1:242845682-242845704 TGTAAAGTGATATCTCCTTGTGG + Intergenic
924367582 1:243312239-243312261 GGTAATATGATAACAGCTTATGG - Intronic
1062870746 10:901416-901438 AATAATGTGAGAGCACCTTAGGG + Intronic
1063081223 10:2769595-2769617 TGTAAGGTGGTATCACATTGAGG - Intergenic
1063584189 10:7336487-7336509 TGTAATGAGATATCAGGATAAGG + Intronic
1063702917 10:8402998-8403020 TGTAATTTGCGATCACTTTATGG + Intergenic
1063751411 10:8952711-8952733 TGTAATCTCATCTCACCTTCTGG + Intergenic
1064246663 10:13673345-13673367 TGTAATGTGATCTCACTCCACGG + Intronic
1064444403 10:15380618-15380640 GGTTATGTGATATCACTCTATGG + Intergenic
1065658095 10:27973983-27974005 TGTAAGATGATATCTCATTATGG + Intronic
1067154730 10:43769314-43769336 TGTAAAGTGATATCTCATCATGG + Intergenic
1067264484 10:44726103-44726125 TGTAATGTGGTATCTCCTTGCGG + Intergenic
1068327773 10:55516883-55516905 TGTAATTTTATATCAGCTAATGG + Intronic
1070468287 10:76748313-76748335 TGTAAGGTGATATCTCATTGTGG - Intergenic
1071533492 10:86407734-86407756 TATAATGTGCTATCTTCTTAAGG - Intergenic
1072384132 10:94906344-94906366 TGTGATGTGATATCTCATTGTGG + Intergenic
1073953930 10:108845480-108845502 TGTAATATGCTATCACATTATGG - Intergenic
1074655071 10:115576435-115576457 TGTCAGGTGATATCTCATTATGG + Intronic
1075324678 10:121521609-121521631 TGTCATGTGATAGCTCCTTGTGG - Intronic
1077789580 11:5424012-5424034 AGTACAGTGATATGACCTTAAGG + Intronic
1078129281 11:8599576-8599598 TGCGATGTGATATCTCATTATGG - Intergenic
1079771616 11:24467899-24467921 TGTGAGGTGATATCTCCTTGTGG + Intergenic
1080986330 11:37471042-37471064 TATAAGGTGATATCTCATTATGG - Intergenic
1082648516 11:55757839-55757861 GGTAAGGTGATATCACATTGTGG + Intergenic
1084900257 11:72304498-72304520 TGTTCTGTGATATCATCATAAGG - Intronic
1086270597 11:85060939-85060961 TGTGAAGTGATATCTCCTTGTGG + Intronic
1086391418 11:86368701-86368723 TGTAAAGTGGTATAATCTTATGG + Intergenic
1086538158 11:87874736-87874758 TGTAAGGTGATATCTCTTTGTGG - Intergenic
1087124527 11:94610544-94610566 TGTAAGGTGATATCTCATTGTGG + Intronic
1088003638 11:104913706-104913728 TGTGAAGTGATATCACATTGTGG - Intergenic
1088250067 11:107854883-107854905 TATGATGTGTTATCACCATATGG - Intronic
1088413109 11:109557809-109557831 AGTAAGGTGATATCTCATTATGG + Intergenic
1090115240 11:123965053-123965075 TGTGAGGTGATATCTCCTTGTGG + Intergenic
1090396356 11:126421808-126421830 TTTAATGTGAAATCACCTATGGG + Intronic
1090629196 11:128631760-128631782 TGTAAGGTGATATCTCATTATGG + Intergenic
1091535155 12:1400076-1400098 TGTGATGTGGTATCTCATTATGG + Intronic
1092945028 12:13445049-13445071 TGTAAGGTGATATCTCATTGTGG + Intergenic
1093478533 12:19581515-19581537 TGTAAAGTGATATCTCATTGTGG - Intronic
1094390374 12:29942716-29942738 TGTCCTGTGATATCTCATTATGG - Intergenic
1094452737 12:30599847-30599869 TGTAATGTGATCTCTCCAGATGG - Intergenic
1095090881 12:38103298-38103320 TGTAATGTGGTATCTTATTATGG + Intergenic
1095285699 12:40407810-40407832 TGTAATGTGGTCTCACCTGGAGG + Intronic
1095932520 12:47642145-47642167 AGTAAGGTGGTATCACATTATGG - Intergenic
1097927962 12:65151791-65151813 TGTAAGGTGATATCTCATTGTGG - Intergenic
1098679965 12:73340772-73340794 TGTTATGTGATATCTCATTGTGG - Intergenic
1099338065 12:81390476-81390498 TGCAAAGTGATATTTCCTTATGG + Intronic
1100085927 12:90910727-90910749 TGTAATGTGATATCACCTTATGG - Intronic
1100878383 12:98988801-98988823 TATGAAGTGATATCTCCTTATGG + Intronic
1100882983 12:99038929-99038951 TGTAATATGATATCAGCTAGTGG - Intronic
1101187515 12:102294644-102294666 TATAAAGTGATATCTCATTAAGG + Intergenic
1101308496 12:103554925-103554947 GGTAATGTGAAATATCCTTAGGG + Intergenic
1106060537 13:26286941-26286963 AGTAAGGTGGTATCTCCTTATGG - Intronic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1106335651 13:28780260-28780282 AGTAATGTGGTATCACATTATGG + Intergenic
1106622408 13:31383556-31383578 TGTAAGGTGATACCTCATTATGG + Intergenic
1107251741 13:38372072-38372094 AGTAAGGTGGTATCACATTATGG - Intergenic
1108076151 13:46681663-46681685 TTTCATGTGAAATCTCCTTAAGG - Intronic
1109117193 13:58403154-58403176 TGTAAGGTGGTATCTCATTATGG + Intergenic
1109478034 13:62910725-62910747 TGTAAGATGATATCACAGTATGG - Intergenic
1109861303 13:68202070-68202092 TGTGAGGTGATATCACATTATGG + Intergenic
1110470019 13:75848959-75848981 AGTAAGGTGGTATCACATTATGG + Intronic
1110906052 13:80891094-80891116 TTTAAGGTGATATCACTTGATGG - Intergenic
1110976349 13:81840560-81840582 TGTAAGGTGATATCTCATTGTGG - Intergenic
1110990000 13:82028510-82028532 TGAGAAGTGATATCACATTATGG - Intergenic
1111025351 13:82513865-82513887 TGTGAGGTGATATCTCCTTATGG - Intergenic
1111193005 13:84833613-84833635 GGTAAGGTGATATCACATTGTGG + Intergenic
1111486853 13:88913349-88913371 TGTAAGGTGATATCTCGTTGTGG + Intergenic
1111608368 13:90570407-90570429 TGTAATTTGAAATTAGCTTATGG - Intergenic
1113851194 13:113419162-113419184 AGTGATGTGATCTCACCTCACGG + Intergenic
1114396549 14:22368294-22368316 AGTAAGGTGGTATCACATTATGG - Intergenic
1114911896 14:27210774-27210796 TGTGATGTGATCTCAGCTCACGG + Intergenic
1115049137 14:29035178-29035200 TCTCATGTGATATCAGCTCACGG + Intergenic
1115698878 14:35929176-35929198 TGTAGGGTGATATCTCATTATGG - Intronic
1116652529 14:47611645-47611667 AGTAAAGTGATATCACATTGTGG - Intronic
1117737133 14:58779180-58779202 TGTATAGTGGTATCTCCTTAGGG + Intergenic
1119173258 14:72550492-72550514 TGTAATGTGCTATGATGTTAAGG - Intronic
1119339503 14:73864492-73864514 TGTAAAGTGATATCTCCTTGTGG + Intronic
1120131672 14:80815355-80815377 TGTAAGGTGATATCTCATTGTGG - Intronic
1120428806 14:84387482-84387504 TGTAAGGTGATATCTCATTGTGG - Intergenic
1120543629 14:85782308-85782330 TGTAATTAGATATGACCTGAAGG - Intergenic
1121032353 14:90669717-90669739 TGTGATGTGATATCTCATTGTGG - Intronic
1122181495 14:99958375-99958397 AGTAATCTGATATCAGCTTCTGG - Intergenic
1124199196 15:27662609-27662631 TGTGAGGTGATATCTCATTATGG - Intergenic
1125588911 15:40842828-40842850 TGTGATTTGATTTCCCCTTATGG - Intergenic
1125964666 15:43864455-43864477 TGTAAGGTGATATCTCATTGTGG + Intronic
1126191004 15:45878755-45878777 AGTAAGGTGGTATCACATTATGG - Intergenic
1126731733 15:51690358-51690380 AGGAATTTGATATCCCCTTATGG - Intronic
1126971449 15:54116974-54116996 GGTAAGATGATATCACATTATGG + Intronic
1127011856 15:54639940-54639962 TGTGAGGTGATATCTCATTATGG - Intergenic
1127767811 15:62204600-62204622 TGTAAGGTGATATCTCATTGTGG + Intergenic
1129099556 15:73247009-73247031 TGTGATGTGTTATCACCTTAAGG + Intronic
1129129752 15:73483049-73483071 TGTAAGGTGGTATCTCCTTATGG + Intronic
1130650319 15:85758772-85758794 TGTTTTGTGATCTCACCTTCAGG - Intergenic
1130763412 15:86844412-86844434 TGTATAGTGGTATCACCTTGTGG + Intronic
1131625482 15:94115089-94115111 TGTAAGATGATATCTCATTATGG - Intergenic
1135713492 16:24739227-24739249 TGTAAAGTGGTATCTCATTATGG + Intronic
1137810441 16:51347393-51347415 TGCAAGGTGATATCACATTGTGG + Intergenic
1139048252 16:63089843-63089865 TGTAAGATGATATCTCCTTGTGG - Intergenic
1139153431 16:64412124-64412146 AGTAAGGTGATATCTCATTATGG + Intergenic
1140287356 16:73616803-73616825 AGAAATGTGAAATCACCTTCAGG - Intergenic
1140358683 16:74326918-74326940 TGTGAGGTGATATCTCATTATGG - Intergenic
1142793368 17:2287336-2287358 GGTGAGGTGATATCACATTATGG - Intronic
1142897224 17:2989220-2989242 TGTGTAGTGGTATCACCTTATGG + Intronic
1143278064 17:5729334-5729356 GGTAAGGTGATATCACATTGTGG - Intergenic
1143604013 17:7970493-7970515 TGTTATGTGATATCTCATTGTGG + Intergenic
1144474486 17:15573564-15573586 TGTAATATAGTTTCACCTTAGGG + Exonic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148564817 17:48626607-48626629 TGCAATGTGCTATCACGTCAGGG + Intronic
1150187243 17:63196127-63196149 TGTAATGTAATATCAGTTAATGG - Intronic
1150895606 17:69207180-69207202 TGTGAGGTGCTATCACGTTATGG - Intronic
1153506841 18:5809310-5809332 TGTAAGTTGATATCTCTTTATGG + Intergenic
1155662869 18:28272716-28272738 TGTGAAGTGATATCTCCTTATGG - Intergenic
1156268770 18:35512267-35512289 TGAAATGTTATACCACCTTAGGG + Intergenic
1157903856 18:51547903-51547925 TGTGAGGTGATATCTCATTATGG + Intergenic
1159049009 18:63399464-63399486 TTTAATCAAATATCACCTTACGG + Intronic
1159829784 18:73261859-73261881 TTTAATGTGAAATTACATTAAGG - Intronic
1159837193 18:73352635-73352657 TGAAATGGGATATCCCCTTGGGG - Intergenic
1162182377 19:8879101-8879123 AGTAAGGTGGTATCACCTTATGG - Intronic
1163964181 19:20729076-20729098 AGTAAGGTGATATCACATTGTGG - Intronic
1164115875 19:22218025-22218047 AGTAAGGTGATATCACATTGTGG + Intergenic
1164492649 19:28728673-28728695 TGTTTTGTGTTTTCACCTTATGG - Intergenic
1164860313 19:31557510-31557532 AGTAAGGTGATATCACATTGTGG + Intergenic
1166427325 19:42690813-42690835 TGTAATGTGGTATCTCATTGTGG + Intronic
1167415731 19:49370747-49370769 TGTAATGTGAAGGCACCCTAGGG + Intronic
1167767598 19:51494392-51494414 TGTGAGGTGATATCTCATTAAGG - Intronic
925565565 2:5250539-5250561 TGGAGTGTGCTATCACCTTAGGG - Intergenic
925754842 2:7123383-7123405 TGGAATGTGATCTCAGCTCATGG - Intergenic
926072962 2:9915174-9915196 TGTATAGTGATATCTCATTATGG + Intronic
927165117 2:20311721-20311743 TGTAGTGTTAGGTCACCTTATGG - Intronic
928475271 2:31619642-31619664 TGTGAGGTGATATCTCATTATGG + Intergenic
929197517 2:39201253-39201275 AGTAAAGTGGTATCACATTATGG - Intronic
929257163 2:39824833-39824855 TGTGAGGTGATATCTCATTATGG + Intergenic
929401555 2:41588080-41588102 TATAAGATGATATCACATTATGG + Intergenic
929678641 2:43965804-43965826 TGTAAGGTGATATCTCATTGTGG - Intronic
929731974 2:44504667-44504689 TGTATGGTGATATCTCATTATGG + Intronic
932473060 2:71976380-71976402 TGTGAAGTGATATCACCTCGTGG - Intergenic
933562812 2:83909955-83909977 TGTAAAGTGATATCATATTGTGG + Intergenic
936818564 2:116490416-116490438 TGTAATGTGATGGAACTTTAGGG + Intergenic
937445432 2:121953584-121953606 TGTGAGATGATATCTCCTTATGG + Intergenic
938200936 2:129372792-129372814 TTTATTGTGATATCACCATGGGG + Intergenic
938509877 2:131929842-131929864 AGTAAGGTGATATCACATTGTGG - Intergenic
938889237 2:135686108-135686130 TGTGAGGTGATATCTCATTACGG - Intronic
939251594 2:139687795-139687817 TATAAAGGGGTATCACCTTATGG + Intergenic
939858751 2:147392827-147392849 TCTAAAGTGATTTCACCTTCGGG + Intergenic
940974629 2:159929440-159929462 AGTAAAGTGGTATCACATTATGG - Intergenic
941529813 2:166653838-166653860 TGTGATGTGATATCTCATTGTGG + Intergenic
942122291 2:172790152-172790174 TGTAAGGTAATATCTCATTATGG + Intronic
942314626 2:174686105-174686127 TGAAATTTGACATCACCTAAGGG - Intergenic
942785401 2:179695639-179695661 TGTAAAGTGATATCTCATTGTGG - Intronic
945149642 2:206775935-206775957 TGTAAAGTGATATCTCATTGTGG + Intronic
946953002 2:224897876-224897898 TGTAATGGGATTTCACCTGATGG + Intronic
947450963 2:230208557-230208579 TCTCATCTGATATCTCCTTATGG + Intronic
947562393 2:231168114-231168136 TAGAATGTGATATCTTCTTATGG - Intronic
1169536278 20:6544887-6544909 TATAAGGTGATATCTCCTTGTGG + Intergenic
1170086061 20:12533191-12533213 TGTAAAGTGGTATCAAATTATGG + Intergenic
1170112384 20:12819774-12819796 TGTAAGGTGATATCTCATTGTGG - Intergenic
1170289381 20:14751225-14751247 TGTAATGGGATTTCACATTAAGG - Intronic
1170682067 20:18535091-18535113 TGCTGTGTGATTTCACCTTAAGG + Intronic
1170887097 20:20350129-20350151 TGTAAAGTGGTATCTCATTATGG - Intronic
1171564644 20:26169844-26169866 TATAATTTGATTTCAGCTTAAGG + Intergenic
1173017831 20:39242748-39242770 TGTATAGTGATCTCACTTTATGG - Intergenic
1173314067 20:41927759-41927781 TGCAATGTGATAGAACCTGATGG - Intergenic
1173417581 20:42870880-42870902 TGTAAGGTGATATCTCATTGTGG + Intronic
1174133386 20:48361465-48361487 TGTAATTTGATGTCAACTCAAGG - Intergenic
1174731221 20:52919805-52919827 TGTATTCTGGTATCACCTTCTGG - Intergenic
1174961967 20:55167811-55167833 GGTAATATGACATCATCTTAAGG + Intergenic
1175029831 20:55940843-55940865 AGTAAGGTGGTATCACATTATGG + Intergenic
1175069513 20:56321146-56321168 AGTAAGGTGATATCACATTGTGG - Intergenic
1177189953 21:17839813-17839835 TGTAATCTCTGATCACCTTATGG + Intergenic
1177383979 21:20384640-20384662 TGTAAGCTGATAACCCCTTATGG + Intergenic
1177432753 21:21011922-21011944 TGTGAGGTGATATCTCCTTATGG - Intronic
1177871563 21:26579043-26579065 TGTAAGATGATATCTCATTATGG + Intergenic
1177981651 21:27922544-27922566 AGTAAGGTGATATCACATTGTGG + Intergenic
1178324407 21:31632178-31632200 TGTAAGGTGATATCTCATTGTGG + Intergenic
1178388049 21:32172080-32172102 TGTGAGGTGATATCTCCTTGTGG - Intergenic
1180413102 22:12634847-12634869 TGTAATATGATATCTCATTGTGG - Intergenic
1182379408 22:29874144-29874166 TGTTATGTGATATCTCATTGTGG + Intergenic
1182957501 22:34440835-34440857 TGTGAGGTGATATCTCATTATGG - Intergenic
1184054654 22:42036629-42036651 TGTGAAGTGATATCTCATTATGG + Intronic
949314929 3:2742359-2742381 AGTAATGTCATATGTCCTTAGGG - Intronic
949839973 3:8309676-8309698 TGTAAGGTGACATCTCATTATGG - Intergenic
951293060 3:20898420-20898442 TGTACTGTAATATCTCATTATGG - Intergenic
951443823 3:22753678-22753700 TGTAATGTGATATCATGTATGGG + Intergenic
951863379 3:27278828-27278850 TGTAATGTGATGGCACAATATGG + Intronic
953273796 3:41474778-41474800 TGTAAGGTGATATCTCCTTGTGG - Intronic
957624021 3:82635390-82635412 TGTAAAGTGATATCTCTTTGTGG + Intergenic
958070540 3:88605253-88605275 AGTAAGGTGATATCACATTGTGG - Intergenic
958870892 3:99557779-99557801 TGTGAGGTGATATCACATTGTGG - Intergenic
960219123 3:115082920-115082942 TGTAGTGTGCTATTACCTTATGG - Intronic
960347120 3:116546858-116546880 TGTGAGGTGATATCACATTATGG - Intronic
960742232 3:120847191-120847213 TGTGAAGTGATATCTCCTTGTGG + Intergenic
962488939 3:135872115-135872137 TGTGAGGTGATACCACCTTTTGG - Intergenic
963007917 3:140743296-140743318 TGTGAGGTGATATCACATTGTGG - Intergenic
963840527 3:150100489-150100511 TGTAAAGTGATATCTCATTGTGG + Intergenic
965290751 3:166876241-166876263 TGTAAGGTGATATCTCATTGTGG - Intergenic
965676032 3:171197694-171197716 TGTAAAGTGATATCTCATTGTGG - Intronic
965891792 3:173522973-173522995 TGTAGGGTTATATCACCTTGTGG + Intronic
965900029 3:173628248-173628270 TGTCATTTGATATCAACTTTAGG + Intronic
965979327 3:174668067-174668089 TGTGAGGTGATATCTTCTTATGG + Intronic
966032188 3:175362883-175362905 AGTAAGGTGGTATCACCTTGTGG + Intronic
966504304 3:180681781-180681803 TGTAATGAGATACCATTTTAAGG - Intronic
967531962 3:190558487-190558509 TGTATTGTGGTATCTCCTTGTGG + Intronic
967539842 3:190654271-190654293 AGAAATGTGAAATAACCTTAAGG - Intronic
967647051 3:191938186-191938208 TGTATAGTGATATCTCATTATGG + Intergenic
970346288 4:15155390-15155412 AGTAAGGTGATATCACATTGTGG + Intergenic
970564025 4:17313819-17313841 TGTTAGGTGATATCTCATTATGG + Intergenic
971986500 4:33831716-33831738 TATAATTTGATTTCAGCTTAAGG - Intergenic
972184908 4:36516888-36516910 TATAAGGTGACATCACCTAACGG + Intergenic
973019063 4:45177642-45177664 TGTGAAGTGATATCTCCTTGTGG - Intergenic
973173350 4:47173306-47173328 TATACGGTGATAACACCTTAAGG - Intronic
973761019 4:54115793-54115815 TGTAAAGTGATATCTCATTGTGG + Intronic
974454422 4:62108338-62108360 TATAATGTGATACTACCATAAGG + Intergenic
974861616 4:67529019-67529041 TGTAAAGTGGTATCTCCCTAGGG + Intronic
974957950 4:68666712-68666734 TGTAATTTGATATACCCATAGGG - Intronic
975088628 4:70373808-70373830 AGTAAGGTGGTATCACATTATGG + Intronic
975227174 4:71887601-71887623 TGTGAGGTGATATCACATTGTGG + Intergenic
975545129 4:75552684-75552706 TGTATTGTGCTATGACTTTATGG + Intergenic
976445323 4:85124466-85124488 AGTAATGTGGTATCACATTGTGG + Intergenic
978111669 4:104971703-104971725 TGTGATGTGGTATGATCTTATGG - Intergenic
978244391 4:106555298-106555320 TGTAAAGAGGTATCTCCTTATGG - Intergenic
978304945 4:107317208-107317230 AGCAATGTGATATTACCTGATGG + Intergenic
978926142 4:114247577-114247599 TGTAAGGTCATATCTCATTATGG + Intergenic
978990302 4:115073106-115073128 TATGATGTGATATCTCATTATGG - Intronic
979722836 4:123922237-123922259 TGTAAGGTAATATCTCATTATGG + Intergenic
979916250 4:126437759-126437781 TTTGGTGTCATATCACCTTATGG + Intergenic
979986023 4:127316603-127316625 TGTAAGGTGATATCTCATTGAGG - Intergenic
979995870 4:127430266-127430288 AGTAAGGTGGTATCACGTTATGG - Intergenic
980524023 4:133966251-133966273 AGTAATGTGGTATCACATTGTGG - Intergenic
980658212 4:135817608-135817630 TGTAAAGTGGTATCTCATTATGG - Intergenic
980774213 4:137418347-137418369 TGTAATATGTTATCTCATTATGG - Intergenic
981234137 4:142394519-142394541 TGTGAGGTGATATCTCATTATGG + Intronic
981887245 4:149691039-149691061 TGTTAAGTGATATCATATTAAGG + Intergenic
982119166 4:152124031-152124053 AGTAATGTGGTATCACATTGTGG + Intergenic
982641149 4:157963296-157963318 TGTGAGGTGATATCTCATTATGG - Intergenic
983330460 4:166321103-166321125 TATAATGTGATATCTCATTGTGG + Intergenic
983816274 4:172130855-172130877 TGTAATGAAATATCTCTTTATGG - Intronic
984184899 4:176532001-176532023 CCTAATGTGATTTCACCTCAAGG - Intergenic
986042441 5:4006479-4006501 TGTCAAGTGATGTCACCTTGGGG - Intergenic
987533457 5:19151305-19151327 TGTAATGTGATACCTCCTTTTGG + Intergenic
987656201 5:20809869-20809891 TGTGATGTGACATCACATTATGG + Intergenic
987956026 5:24741218-24741240 TGTAAGGTGATATCTCATTGTGG + Intergenic
988767352 5:34394071-34394093 TGTGATGTGACATCATATTATGG - Intergenic
989392342 5:40914165-40914187 TGTAAGATGATATCTCCTTGTGG + Intronic
989437684 5:41433955-41433977 TGTGACGTAATATCACCTGATGG + Intronic
989525459 5:42448295-42448317 TGTAAGGTGATATCACATTGTGG + Intronic
989723530 5:44559043-44559065 AGTAAGGTGGTATCACATTATGG - Intergenic
990927494 5:61044055-61044077 TGTAAGGTGATATCTCATTGTGG + Intronic
991556964 5:67906321-67906343 TGTAAGGTGATATCTCGTTGTGG - Intergenic
991623400 5:68570666-68570688 AGTAAGGTGATATCACATTGTGG - Intergenic
991710625 5:69405052-69405074 TGTAATATGATATCTCATTGTGG - Intronic
992367523 5:76108178-76108200 TGTAATATGAAAGCAACTTAAGG + Intronic
993962404 5:94315783-94315805 TGTAATGCGATTACACATTATGG - Intronic
994002628 5:94798470-94798492 TGTATTGAGATATCAGCTTAAGG - Intronic
994069568 5:95585121-95585143 AGTAAGGTGGTATCACATTATGG - Intronic
995094451 5:108218629-108218651 TGTAAGGTGATATCTCATTGTGG + Intronic
996049076 5:118911298-118911320 TGTAAGGTGATATCTCATTGTGG - Intronic
996244454 5:121244020-121244042 TGTAAAGTGATATCTCATTGCGG - Intergenic
996577710 5:124994321-124994343 TGTAATGTTATATCCCCATCAGG - Intergenic
999111398 5:149124618-149124640 AGTAAGGTGGTATCACATTATGG - Intergenic
999711939 5:154326185-154326207 TGTGAAGTGGTATCTCCTTATGG - Intronic
1000024894 5:157349816-157349838 AGTAAGGTGATATCACATTGTGG + Intronic
1000525163 5:162348558-162348580 AGTAATGTGGTATCACATTGTGG + Intergenic
1000559116 5:162763845-162763867 TGTAAAGTGATATCTCATTATGG - Intergenic
1002192387 5:177485093-177485115 AGTAATGTTAGATCACGTTACGG - Intronic
1002654608 5:180734823-180734845 TGTGAGGTGATATCTCATTATGG + Intergenic
1002679004 5:180946080-180946102 TGTAAGGTGATATCTCATTGTGG - Intronic
1003123732 6:3338818-3338840 TGTAAGATGATGTCACCTTTGGG + Intronic
1004396056 6:15247659-15247681 TGTAATGAGAGATGACCTTCGGG + Intronic
1008786191 6:55171330-55171352 TGTACCATGATATCCCCTTAAGG - Intronic
1009002946 6:57742875-57742897 TGTGAGGTGATATCTCCTTGTGG + Intergenic
1009526959 6:64759279-64759301 TGTAGTGTGAAATCAGCTCATGG + Intronic
1010488322 6:76443370-76443392 TGTAAGGTGATATCTCATTGTGG + Intergenic
1010557161 6:77296585-77296607 GGTAAGGTGATATCTCATTATGG + Intergenic
1011109026 6:83815785-83815807 TGTAATGTTATTCCAACTTATGG - Intergenic
1011909480 6:92418085-92418107 AGTAATGCTATATCATCTTAGGG - Intergenic
1012030267 6:94051418-94051440 TGTAATGTAATATTACACTAAGG + Intergenic
1012094489 6:94941877-94941899 TGTTAGGTGATATCTCATTATGG - Intergenic
1012341889 6:98136803-98136825 TTTCAAGTTATATCACCTTAAGG - Intergenic
1012860470 6:104553198-104553220 TGTGAGGTGATATCTCATTATGG - Intergenic
1013257759 6:108406350-108406372 TGTGAAGTGATATCTCATTATGG + Intronic
1013954163 6:115820988-115821010 AGTAAGGTGATATCCCATTATGG - Intergenic
1013985121 6:116182586-116182608 AGTAAGGTGGTATCACATTATGG + Intronic
1014056167 6:117017442-117017464 TGTAAGGTGGTATCACATTGTGG - Intergenic
1014077685 6:117255364-117255386 TGTAAACAGATATCACATTATGG - Intergenic
1014390777 6:120860090-120860112 TGTGAGGTGATATCACATTGTGG + Intergenic
1015071170 6:129095000-129095022 TGTAATGTGCTTCCACGTTATGG - Intronic
1015159039 6:130131280-130131302 TGTATAGTGGTATCACATTATGG - Intronic
1015210294 6:130689350-130689372 TGTGAGGTGATATCTCATTATGG + Intergenic
1015228490 6:130886086-130886108 TGTAAAGTGAAATGACCTTGTGG - Intronic
1015877513 6:137838035-137838057 AGTAAGGTGATATCACGTTGTGG + Intergenic
1017287442 6:152692218-152692240 TGTGAGGTGATATCTCCTTGTGG + Intergenic
1017370198 6:153696225-153696247 TGTGATTTTGTATCACCTTATGG + Intergenic
1018704518 6:166453510-166453532 TGTAAGGTGATATCTCATTGTGG - Intronic
1018740828 6:166727514-166727536 TGTAATGTGCCAGCACCCTAAGG + Intronic
1020667618 7:11067960-11067982 TGAAATGTGATCCCACTTTAGGG - Intronic
1021039955 7:15849090-15849112 TGTAATATGATAACACCTTTGGG - Intergenic
1021154168 7:17189049-17189071 TGTAAGGTAATATCTCATTATGG + Intergenic
1021176456 7:17455585-17455607 AGTAAGGTGATATCACATTGTGG - Intergenic
1021636013 7:22694263-22694285 TGTGAAGTGATATCACGTTGTGG - Intergenic
1022597652 7:31728062-31728084 TTTTATGTGATATCCACTTAAGG + Intergenic
1022952570 7:35352484-35352506 TGCCATGTGATAGCCCCTTAGGG + Intergenic
1023341297 7:39223130-39223152 TGTGAAGTGATATCTCATTATGG + Intronic
1024499640 7:50091014-50091036 AGTAAGGTGATATCACATTGTGG + Intronic
1025868715 7:65410308-65410330 TGTAAAGTGATATCTCTTTGTGG - Intergenic
1028122915 7:87077515-87077537 TTCAATCTGATTTCACCTTAAGG + Intergenic
1028525773 7:91784649-91784671 TGTGATATGATGCCACCTTATGG + Intronic
1029865826 7:103627390-103627412 TTTAATGTGAATTCACCTTGGGG - Intronic
1031057597 7:117010588-117010610 TGGGATGTGACATAACCTTAAGG + Intronic
1031301191 7:120063132-120063154 TGTAAGGTGATATCTCATTGTGG - Intergenic
1031644795 7:124211172-124211194 AGTAAGGTGATATCACATTGTGG - Intergenic
1031782115 7:125981167-125981189 TGTAAAGTGATATCTCATTGTGG + Intergenic
1032978392 7:137252234-137252256 TGTAGAGTGATATCTCATTATGG + Intronic
1033317721 7:140311852-140311874 TGTAAAGTGATATCTCATTGTGG + Intronic
1034705073 7:153134554-153134576 GGTAAGGTGGTATCACATTATGG + Intergenic
1035909733 8:3553188-3553210 TGCAATGTAATATCACTTCATGG + Intronic
1039358685 8:36850025-36850047 TGTAAAGTGGTATCTCATTATGG + Intronic
1039946100 8:42129821-42129843 TGTAAAGTGACATCTCCTTGTGG + Intergenic
1040421618 8:47245070-47245092 TGTAAAGTGATATCTCCTTGTGG + Intergenic
1041176197 8:55199303-55199325 TGTAATCTGATATCACAGAAAGG - Intronic
1041360115 8:57044127-57044149 TGTAATGTGATATATCTGTACGG - Intergenic
1041768243 8:61442937-61442959 TGTAGTGTGATATCTCATTGTGG + Intronic
1042055494 8:64760640-64760662 TGTGAGGTGATATCTCATTATGG - Intronic
1043205220 8:77429718-77429740 TCTATGGTGATATCACATTATGG + Intergenic
1043331957 8:79128336-79128358 TGAAATGTGCTATCACTTTGGGG + Intergenic
1043417084 8:80062520-80062542 TGTGAAGTGATATCTCATTATGG - Intronic
1043809152 8:84713510-84713532 TGTGATGTGATATATCCTTGTGG - Intronic
1044167888 8:89010745-89010767 TGTAATGTTATATGAGCTGAAGG - Intergenic
1044316716 8:90757638-90757660 TTTAATGTTATATCTTCTTAGGG + Intronic
1045881386 8:107045055-107045077 AGTAAGGTGATATCACATTGTGG - Intergenic
1046283994 8:112072433-112072455 TGTAATGTCATATAATTTTAAGG + Intergenic
1046763996 8:118050048-118050070 TGAAATGTCATTTTACCTTAAGG - Intronic
1047813852 8:128440984-128441006 TGTAAAATGATATCTCATTATGG - Intergenic
1048096659 8:131302778-131302800 TGTAAAGTGATATCTCATTGTGG + Intergenic
1049065747 8:140312384-140312406 TCTACTGTGCTACCACCTTAGGG + Intronic
1050996077 9:12219122-12219144 AGTAAGGTGATATCACATTGTGG + Intergenic
1051319504 9:15886405-15886427 TGTGATGTGATATCTCATTGTGG - Intronic
1051454478 9:17239011-17239033 TGTGAAGTGATATCTCATTATGG + Intronic
1051594878 9:18814997-18815019 GGTAAGGTGATATCACATTTTGG - Intronic
1052089261 9:24307425-24307447 TGTGAGGTGATATCTCATTATGG - Intergenic
1052561168 9:30086486-30086508 TATAATGTGATATAAATTTAAGG + Intergenic
1052832323 9:33226590-33226612 TGTAAAGTGATATCTCATTGTGG - Intronic
1053389347 9:37723102-37723124 TGTAATGAAATATCACCAAAGGG - Intronic
1053471541 9:38349362-38349384 AGTAAGGTGATATCACATTGTGG + Intergenic
1053549709 9:39063210-39063232 TGTAATATGATATCTCATTTTGG + Intergenic
1053813822 9:41883304-41883326 TGTAATATGATATCTCATTTTGG + Intergenic
1054616774 9:67304136-67304158 TGTAATATGATATCTCATTTTGG - Intergenic
1054998199 9:71417340-71417362 TGTATAGTGATATCTCATTATGG + Intronic
1056243877 9:84674939-84674961 TGAAAAGTGATATTTCCTTATGG + Intronic
1056696609 9:88861295-88861317 AGTAAAGTGATATCACATTGTGG - Intergenic
1058540220 9:106003991-106004013 AGTAAGGTGGTATCACATTATGG + Intergenic
1058680539 9:107436822-107436844 TGCAAGGTGATATCTCCTCATGG - Intergenic
1059033159 9:110722828-110722850 AGTAAGGTGATATCACGTTGTGG - Intronic
1059050165 9:110915989-110916011 TATACAGTGATATAACCTTATGG + Intronic
1060861555 9:126958982-126959004 TGTGATGTGGTATCTCATTATGG + Intronic
1185922287 X:4107068-4107090 TGTGAGGTGATATCACGTTGTGG + Intergenic
1186088390 X:6016407-6016429 TGTAAAGTGATATCATGTTTGGG - Intronic
1186845314 X:13524993-13525015 TGTAATGTGATATCAGGACATGG + Intergenic
1187371403 X:18710617-18710639 TGTAAGGTGGTATCTCATTATGG - Intronic
1187600372 X:20822963-20822985 TGTAATATCCTATGACCTTAAGG - Intergenic
1187632618 X:21191798-21191820 TGTAAGATGATATCTCATTATGG - Intergenic
1188170976 X:26926020-26926042 TGTAATGTGAAATAATATTAGGG - Intergenic
1188260687 X:28019406-28019428 TTTAAGGTGATATCTCATTATGG + Intergenic
1188264679 X:28057518-28057540 TGTAAAGTGATATCTCATTGCGG - Intergenic
1188336576 X:28942382-28942404 TGTAATGTTATATTACATCATGG + Intronic
1188728722 X:33618722-33618744 TGAAATATGATTTCATCTTACGG + Intergenic
1189218609 X:39350078-39350100 AGTAAGGTGGTATCACATTATGG - Intergenic
1189659694 X:43284195-43284217 TGTAAGATGATATCTCATTATGG + Intergenic
1189943060 X:46146892-46146914 TGTATAGTGATATCTCCTTATGG + Intergenic
1190514960 X:51214398-51214420 TGTACAGTGATATCACATTGTGG - Intergenic
1190900122 X:54663745-54663767 TGTAAAGTGATATCTCTTTATGG + Intergenic
1191918562 X:66228816-66228838 AGTAATGTGATATCACACTGTGG - Intronic
1191928164 X:66338583-66338605 TGTGATGTGGTATCTCATTATGG + Intergenic
1192791394 X:74385003-74385025 AGTAAGGTGATATCACATTGTGG + Intergenic
1192987320 X:76414252-76414274 AGTAAGGTGGTATCACATTATGG - Intergenic
1192994624 X:76499758-76499780 AGTAACGTGATATCACATTGTGG + Intergenic
1193766670 X:85537094-85537116 TGTGAGGTGATATCTCCTTGTGG - Intergenic
1193859504 X:86646964-86646986 TGTGAGGTGATATCTCATTACGG - Intronic
1194207179 X:91025468-91025490 TGTAATGTGTGATCTCATTATGG - Intergenic
1194983924 X:100469773-100469795 TGTGAGGTGATATCTCATTATGG - Intergenic
1195640251 X:107166350-107166372 TGTGAAGTGATATCTCATTATGG - Intronic
1196023561 X:111015651-111015673 TGTAAGGTGATATCTCATTGTGG + Intronic
1196163676 X:112514284-112514306 TTTCATTTGATATCTCCTTAAGG - Intergenic
1196164582 X:112524531-112524553 TGTGAGGTGATATCTCCTTGTGG + Intergenic
1196930693 X:120679029-120679051 TGTGAGGTGATATCTCATTATGG + Intergenic
1197668636 X:129250935-129250957 AGTAAAGTGATATCACATTGTGG + Intergenic
1197971266 X:132117689-132117711 TGTGATGTAATAACACCTTTTGG + Intronic
1198488561 X:137113670-137113692 TGTGTTGTGATATCTCATTATGG + Intergenic
1198842286 X:140870839-140870861 TGTAAGATGATATCCCATTATGG - Intergenic
1199299963 X:146201663-146201685 TGTGAGGTGATATCTCCTTGTGG + Intergenic
1199328396 X:146529205-146529227 TGTAAGGTGATATCTCATTTTGG + Intergenic
1199584576 X:149400769-149400791 AGTAAGGTGATATCACATTGTGG - Intergenic
1199640038 X:149850974-149850996 AGTAAGGTGGTATCACCTTGTGG - Intergenic
1200552921 Y:4600227-4600249 TGTAATGTGTGATCTCATTACGG - Intergenic
1202589896 Y:26471836-26471858 TGTATTGTGAAATCATCATAGGG + Intergenic