ID: 1100087688

View in Genome Browser
Species Human (GRCh38)
Location 12:90931374-90931396
Sequence ACTTGGACATGGATGTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100087688_1100087693 29 Left 1100087688 12:90931374-90931396 CCTGTAAACATCCATGTCCAAGT 0: 1
1: 0
2: 7
3: 32
4: 199
Right 1100087693 12:90931426-90931448 CTGAGTAGATATGCAGTAGTGGG 0: 1
1: 16
2: 146
3: 1179
4: 2354
1100087688_1100087692 28 Left 1100087688 12:90931374-90931396 CCTGTAAACATCCATGTCCAAGT 0: 1
1: 0
2: 7
3: 32
4: 199
Right 1100087692 12:90931425-90931447 TCTGAGTAGATATGCAGTAGTGG 0: 1
1: 18
2: 152
3: 1239
4: 2441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100087688 Original CRISPR ACTTGGACATGGATGTTTAC AGG (reversed) Intronic
900693940 1:3998630-3998652 AATTAGACATGGATTTGTACTGG - Intergenic
901136143 1:6997601-6997623 CCTGTGACATGGATGTTGACAGG + Intronic
906566716 1:46806150-46806172 ACTTGGGCAGGGATTCTTACTGG + Intronic
909919793 1:81367165-81367187 ACTTGGACAAGCCTGTTTCCAGG + Intronic
911670155 1:100598688-100598710 ACATGCACATGTATGTTTATTGG - Intergenic
915548503 1:156617772-156617794 ATTTCTACATGGCTGTTTACAGG + Intergenic
917699279 1:177563765-177563787 ACATGCACATGTATGTTTATTGG - Intergenic
917709737 1:177672261-177672283 ACATGCACATGTATGTTTATTGG - Intergenic
917727888 1:177845090-177845112 ACATGCACATGTATGTTTATTGG + Intergenic
919239448 1:194892555-194892577 ACTTGTACATGAATGTTTAAAGG + Intergenic
920720901 1:208385956-208385978 CCTGGGACATTGATGTTTTCTGG + Intergenic
922344666 1:224686456-224686478 ACATGCACACGTATGTTTACTGG - Intronic
1063398443 10:5716322-5716344 ACTTGTACATGTATGTTCATAGG - Intronic
1063940834 10:11127343-11127365 ACATGCACACGTATGTTTACTGG - Intronic
1067856809 10:49801113-49801135 ACTTGCACATGAATGTTTATAGG - Intergenic
1070433559 10:76365203-76365225 ACATGCACATGCATGTTTACAGG - Intronic
1070944963 10:80382954-80382976 AGTTGGAGATGGATGTTCATGGG - Intergenic
1071151627 10:82642040-82642062 ACGTGGACATAGATATTTAGTGG - Intronic
1073875071 10:107913844-107913866 CCTTGGATATTGATGTTTCCAGG + Intergenic
1074139857 10:110662229-110662251 AATTGGAAATGAAAGTTTACTGG - Intronic
1074221385 10:111441594-111441616 CTTTGGGCATGGATGTGTACAGG + Intergenic
1074447927 10:113535553-113535575 ACATGCACATGTATGTTTATTGG - Intergenic
1077100153 11:819078-819100 CCTTGGCCTTGGATGTTTATGGG + Intronic
1079398567 11:20086890-20086912 ACCTGGATATGGATGTCTGCTGG - Intronic
1083999948 11:66290579-66290601 TCTTGGACACAGATGTTTATTGG - Intergenic
1084674979 11:70629038-70629060 ACTTGGAGAGGGATGGTTTCAGG + Intronic
1084800364 11:71539587-71539609 ATTTGGAGATAGATCTTTACAGG - Intronic
1085889967 11:80566957-80566979 ACTTGCACACGCATGTTTACAGG + Intergenic
1086761479 11:90636646-90636668 ACATGCACATGTATGTTTATTGG - Intergenic
1086774769 11:90816533-90816555 ACATGCACACGTATGTTTACTGG - Intergenic
1087572205 11:99942999-99943021 ACATGCACATGTATGTTTATTGG - Intronic
1088038602 11:105349540-105349562 ACATGCACATGTATGTTTATTGG + Intergenic
1088092222 11:106055947-106055969 AATTGGAGATAGATGTTAACTGG - Intronic
1088375502 11:109136309-109136331 ACTTGGAGTTTGATGTTTAAGGG - Intergenic
1088683279 11:112263511-112263533 ACTTGTACATGAATGTTTATAGG + Intronic
1090146439 11:124328275-124328297 ACTCGCACATGCATGTTTATAGG - Intergenic
1091578881 12:1767728-1767750 TATTGGATATGGATATTTACAGG + Intronic
1091960976 12:4693972-4693994 ACTTGGAAATGGAAGTGTAGGGG + Exonic
1092297470 12:7211911-7211933 ACTTGGAGATAGATGTTTGTGGG + Intronic
1092315193 12:7404891-7404913 ACTTGGAGATTGATTTATACAGG + Intronic
1092968785 12:13671669-13671691 ATTTAGACATAGAAGTTTACTGG - Intronic
1093475114 12:19546310-19546332 ATTGGGACATGCATGTTTGCTGG + Intronic
1093769844 12:23005592-23005614 ACTTGCACATGAATGTTTACTGG + Intergenic
1094237764 12:28188212-28188234 ACTTGTACATGAATGTCAACAGG + Intronic
1096205842 12:49721160-49721182 ATCTGCACATGGATGTTTCCAGG - Intronic
1100087688 12:90931374-90931396 ACTTGGACATGGATGTTTACAGG - Intronic
1100710751 12:97253726-97253748 TCTGGGACTTGTATGTTTACTGG + Intergenic
1101442510 12:104714200-104714222 ACTTGAACAAGTTTGTTTACAGG - Intronic
1105227015 13:18445229-18445251 ACATGCACATGTATGTTTACTGG + Intergenic
1106541314 13:30692544-30692566 ACTTGCACATGTATGTTTATTGG - Intergenic
1107636823 13:42400534-42400556 ACTTGGACACAGATTTTGACAGG - Intergenic
1111068458 13:83130108-83130130 TCTTGAACATGGATGCTTTCTGG - Intergenic
1115702318 14:35966136-35966158 ACTTGGTCATCGATTTTTAATGG + Intergenic
1117654943 14:57945572-57945594 ACTTGCACATGCATGTTTATAGG - Intronic
1120776297 14:88441297-88441319 ACTTGCACACGCATGTTTATAGG - Intronic
1125819429 15:42615307-42615329 CCATGGTCAAGGATGTTTACTGG + Intronic
1126122793 15:45268429-45268451 ATTTGGACATGCATGTTTGAAGG - Intronic
1126787455 15:52189295-52189317 ACTTGAAAATGTATGTTCACTGG + Intronic
1127311978 15:57760427-57760449 ATTAGGACATGGACGTTTTCGGG + Intronic
1128123628 15:65173586-65173608 ACTTGTACACAGATGTTCACGGG + Intronic
1129935256 15:79442828-79442850 ACTGGTATATGGATGTCTACTGG - Intronic
1133557669 16:6920908-6920930 ACTTGGACATAGGTTTTTGCAGG + Intronic
1133688093 16:8186150-8186172 GCTTGGACATGAATATTTACAGG + Intergenic
1135596240 16:23745483-23745505 ACTTGTACACGGATGTTTACAGG - Intergenic
1135948612 16:26890137-26890159 ACTTGCACATGTATGTTTATAGG - Intergenic
1136137735 16:28267527-28267549 ATTAGGACATGGATGTTTGCAGG + Intergenic
1142160027 16:88552559-88552581 ATTTGGACATGGAGGAGTACGGG - Intergenic
1144300079 17:13915238-13915260 ATTTGGAGATGGATGTTCAGAGG + Intergenic
1148969244 17:51464807-51464829 ACAAGGACACGGATGTATACGGG + Intergenic
1149071518 17:52549428-52549450 ACATGCACACGTATGTTTACTGG - Intergenic
1149643610 17:58221774-58221796 ACATGCACACGTATGTTTACTGG - Intronic
1153935940 18:9921757-9921779 ACTTGCAAATGCTTGTTTACTGG + Intronic
1154393857 18:13969213-13969235 ACTTGTACATGAATGTTTATAGG + Intergenic
1154526362 18:15294243-15294265 ACATGCACATGTATGTTTACTGG - Intergenic
1155584271 18:27346974-27346996 AATTGGACCTGGAAGTTCACAGG - Intergenic
1156057515 18:33025907-33025929 ACCTGTGCATGGATGTTTATAGG + Intronic
1157608078 18:48938863-48938885 GCTTGGACATGGATGTGTCATGG - Intronic
1158504687 18:58036129-58036151 ACTGGGACAGGGACATTTACTGG + Intergenic
1159005804 18:63009446-63009468 ACCTGCACATGGATATTTATAGG - Intergenic
1162703206 19:12534908-12534930 ACCTGTACATGGATGTTTATGGG + Intronic
926185019 2:10683526-10683548 CCTTGGACCTGCATGCTTACTGG + Intronic
928156821 2:28884334-28884356 ACTTGTACATAAATGTTCACAGG - Intergenic
930224680 2:48780079-48780101 ACTTGTACATGAATGTTCACGGG + Intergenic
930293090 2:49520143-49520165 ACATGCACATGTATGTTTATTGG + Intergenic
930712882 2:54565781-54565803 AATAGTACATGGATGTTTCCAGG - Intronic
930913578 2:56660753-56660775 ACATGCACATGTATGTTTATTGG - Intergenic
930922363 2:56771952-56771974 ACTTGGAGACTGATGTTTAAAGG + Intergenic
932273520 2:70433288-70433310 ACTTGCACATAAATGTTCACAGG - Intergenic
932402498 2:71490903-71490925 ATTTGGATAAAGATGTTTACTGG - Intronic
933397232 2:81749118-81749140 ACTTGTACATGAATGTTTATAGG + Intergenic
933784121 2:85824840-85824862 ACTTGTACATGAATGTTCATGGG - Intergenic
937049977 2:118880681-118880703 AATTGGACATTGTTGTTTAACGG + Intergenic
937344953 2:121119706-121119728 ACTTGGACATGGATTTTTGGGGG - Intergenic
937407069 2:121639911-121639933 ACATGCACACGTATGTTTACTGG + Intronic
938525464 2:132125608-132125630 ACATGCACACGTATGTTTACTGG - Intergenic
939845282 2:147236627-147236649 ACTTGTACAAGAATGTTTATAGG - Intergenic
940028408 2:149233921-149233943 ACATGCACATGCATGTTTATAGG + Intergenic
940045196 2:149402337-149402359 ATTTGCACATGCATGTTTACAGG - Intronic
941604095 2:167575283-167575305 GCCTGGATATGGATGTTTTCTGG + Intergenic
942912302 2:181259144-181259166 AATTGGACATGAATTGTTACTGG - Intergenic
945393618 2:209295429-209295451 ACTTGCACATGCATGTTTACAGG + Intergenic
947911262 2:233802422-233802444 ATTTGGACTTGGATGTTTCCAGG - Intronic
1168748891 20:268121-268143 ACATGCACATGGATGCATACTGG - Intergenic
1168805693 20:671183-671205 AATTGGACATGGATTTGTCCTGG + Intronic
1170499247 20:16957688-16957710 ACTTGGAGTTGGATGTTTGAGGG - Intergenic
1171052490 20:21872960-21872982 ACCTGCACATTAATGTTTACAGG - Intergenic
1174781211 20:53390594-53390616 ACATGTACATGTATGTTTATTGG - Intronic
1174782696 20:53404750-53404772 TCTTGGACTTGGATGATTATAGG - Intronic
1175206713 20:57317005-57317027 CCTTTGACCTGGTTGTTTACTGG - Intergenic
1175376280 20:58526496-58526518 ACTTGTACGTGAATGTTTATAGG - Intergenic
1175768603 20:61608391-61608413 ACTTGGACAGGGATGCTTTGTGG - Intronic
1176771062 21:13074251-13074273 ACATGCACATGTATGTTTACTGG + Intergenic
1177832327 21:26152833-26152855 ACTTGTACACATATGTTTACAGG + Intronic
1181432283 22:22888741-22888763 ACTTGCACATAAATGCTTACTGG + Intronic
1181909324 22:26225987-26226009 ACTTGGAGATGGATGGATAAGGG - Intronic
1183009164 22:34930701-34930723 ACTTTGACAGGGAAGCTTACTGG + Intergenic
1183471557 22:38009972-38009994 ACTTGTACATGAATGTTCATAGG - Intronic
1185012770 22:48324786-48324808 AGTTGGATATGGATATTTAATGG - Intergenic
949194993 3:1294486-1294508 ACTTGGGGAAGGATGGTTACAGG + Intronic
949352901 3:3143575-3143597 TCTTGGAAATGGGTATTTACTGG + Intronic
949370527 3:3329639-3329661 ACTTGGATCTGGATGTTAGCAGG + Intergenic
949935224 3:9110913-9110935 ACGTGGGCATGGGTGTTCACCGG + Intronic
951326427 3:21307780-21307802 ACTTGCACACGCATGTTTATAGG + Intergenic
951328274 3:21332197-21332219 AATTGGACAGGGATGTGTGCTGG - Intergenic
951570156 3:24053939-24053961 ACTTGCACACGTATGTTTATTGG - Intergenic
951572469 3:24079400-24079422 ACTTGCACACGTATGTTTATTGG - Intergenic
953173487 3:40528445-40528467 ACCTGTACATGGACATTTACAGG - Intronic
956764460 3:72472643-72472665 ACTTGGACATGTATCTTCCCAGG - Intergenic
957242364 3:77675305-77675327 ACTTGGAGTTGGATGTTCAAGGG - Intergenic
957510056 3:81176255-81176277 ACTTGGAGTTGGATGTTCAAGGG + Intergenic
957866415 3:86029721-86029743 ACTCTGACTTGGATGTTGACAGG + Intronic
958673003 3:97228673-97228695 ACTTGCGCATGCATGTTTATAGG - Intronic
958747267 3:98152340-98152362 ACATGCACATGTATGTTTACTGG + Intergenic
959297758 3:104558631-104558653 ACCTGCACATGTATGTTCACTGG - Intergenic
960535150 3:118807417-118807439 ACTTGTACATGCATGTTTATGGG + Intergenic
961157530 3:124692887-124692909 ATCTGGACATGGATGATTAGTGG + Intronic
963399950 3:144785739-144785761 ACATGCACATGTATGTTTATTGG - Intergenic
963446422 3:145414979-145415001 ATTTTTACATGCATGTTTACTGG + Intergenic
964341100 3:155709232-155709254 ACTTGCACATGGATGTTTGCAGG - Intronic
964456162 3:156869149-156869171 ACTTGTACTTGAATGTTTATTGG - Intronic
965254161 3:166382404-166382426 ACATGCACATGTATGTTTATTGG - Intergenic
969661983 4:8535708-8535730 CCTTGGACATGGATGCTTACAGG - Intergenic
970530817 4:16981196-16981218 ACTTGCTCATGAATGTTTATAGG + Intergenic
971451087 4:26802714-26802736 AGATGCACATTGATGTTTACAGG + Intergenic
972166876 4:36297428-36297450 ACTTGGAAATGAATGTCTAAGGG - Intronic
974343791 4:60651371-60651393 ACTTGGAAATGGATATCTATAGG - Intergenic
975152686 4:71037887-71037909 ACCTGCACATGGATGTTTATAGG - Intergenic
977472435 4:97457293-97457315 ACCTGCACATGAATGCTTACAGG + Intronic
978397715 4:108299500-108299522 ACTTGCACATGCATATTTATAGG - Intergenic
978526567 4:109673252-109673274 AAGTGGAAATAGATGTTTACAGG + Intronic
979950184 4:126882894-126882916 ACTTTGACATTGATATTTAGTGG + Intergenic
980397697 4:132236181-132236203 ACCTGCACATGTATGTTTATTGG + Intergenic
980597454 4:134972699-134972721 ACATGCACATGTATGTTTATTGG + Intergenic
981346100 4:143678081-143678103 ACATGCACACGTATGTTTACTGG + Intronic
982942425 4:161574797-161574819 ACATGCACATGTATGTTTATTGG - Intronic
983291026 4:165805842-165805864 ACTTAAACATGAATGTCTACTGG - Intergenic
983964352 4:173791582-173791604 ACATGCACATGTATGTTTATTGG + Intergenic
986079042 5:4370144-4370166 TCTTGGACATGGATGTCTGTAGG - Intergenic
986598152 5:9444640-9444662 ACTTGCACATGCATGTTTATAGG - Intronic
987724849 5:21684789-21684811 AAGTGGACATGAATTTTTACGGG + Intergenic
988021327 5:25626047-25626069 ACTGGGGCATGGATATTTGCTGG + Intergenic
989409762 5:41105785-41105807 ACCTGCACATGAATGTTTATAGG - Intergenic
989411769 5:41127589-41127611 ACTAGGACTTGGATGTTTTGTGG - Intergenic
993229371 5:85212075-85212097 ACTTGGAGTTGGATGTTCAAGGG - Intergenic
993287897 5:86023545-86023567 ACATGCACATGTATGTTTATTGG - Intergenic
993412251 5:87589195-87589217 ACTTGTAGTTGGATGTTTAAAGG + Intergenic
995172008 5:109125443-109125465 ACTTAGTCACAGATGTTTACAGG - Intronic
995524461 5:113039473-113039495 ACTAAGACATGGCTGTTTACTGG + Intronic
995766765 5:115627378-115627400 ACTTGGACATGTATTTTTTAGGG - Intronic
997005403 5:129811032-129811054 ACTAGGACATGGAGGTTTCAGGG - Intergenic
997296990 5:132774647-132774669 ACTTTGAGATGGATGTGTGCTGG - Intronic
998826839 5:146110612-146110634 ACAAGCGCATGGATGTTTACTGG + Intergenic
1001264914 5:170267182-170267204 AAATGGACATGGATGTTTGTAGG - Intronic
1003470801 6:6429758-6429780 ACATGGACACGTATGTTTATTGG + Intergenic
1004200049 6:13540039-13540061 ACTTGTACAAGAATGTTTACAGG + Intergenic
1004519071 6:16345330-16345352 AATTGGATATGAATGTTTAGAGG - Intronic
1008093102 6:47312033-47312055 ACTTAGACATGTCTGTTTTCTGG + Intergenic
1008243773 6:49145555-49145577 ACATGCACATGTATGTTTATTGG - Intergenic
1011379402 6:86726247-86726269 ACTGGGACATGGATGTCTTTTGG + Intergenic
1011607739 6:89120392-89120414 ACTTGGACATGTATTTTTGGGGG + Intergenic
1011709085 6:90032898-90032920 ACATGCACATGTATGTTTATTGG + Intronic
1012719909 6:102727904-102727926 ACATGCACATGTATGTTTATTGG - Intergenic
1012974509 6:105765633-105765655 ACTTAGTCATGGAAGTTCACAGG + Intergenic
1013930818 6:115530439-115530461 ACTTGCACATGTATGTTTACAGG - Intergenic
1014324249 6:119972021-119972043 ACCTGCACATGGATATTTACAGG + Intergenic
1017290932 6:152735526-152735548 CCATGGACATTGATGTTTAGAGG + Intergenic
1018125719 6:160680169-160680191 ACATGCACATGTATGTTTATTGG - Intergenic
1019631474 7:2051976-2051998 TGTTGGGAATGGATGTTTACAGG + Intronic
1021306137 7:19034696-19034718 ACATGCACACGTATGTTTACTGG - Intronic
1021428506 7:20532103-20532125 ACCTGGAACTGAATGTTTACTGG - Intergenic
1023052682 7:36267024-36267046 ACTTGTACATGAATGTTCACAGG - Intronic
1023214352 7:37846387-37846409 ACATGCACATGTATGTTTATTGG + Intronic
1026890398 7:73978461-73978483 TGTTGGACATGGGTGTGTACCGG - Intergenic
1028628659 7:92907571-92907593 AATTTGACATGAATGTTTGCAGG - Intergenic
1030890221 7:114990798-114990820 ACATGCACATGTATGTTTATTGG - Intronic
1031760644 7:125709286-125709308 ACTTGCATATGCATGTTTATAGG - Intergenic
1033424723 7:141233681-141233703 ACTTTGACATGGACTTTTGCTGG + Intronic
1033782742 7:144692111-144692133 ACATGCACATGTATGTTTATTGG - Intronic
1033888490 7:145978167-145978189 ACATGCACATGTATGTTTATTGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1034867452 7:154654382-154654404 ATTTGGATATAGATGTTTTCAGG - Intronic
1036109934 8:5887269-5887291 ACATGCACACGTATGTTTACTGG + Intergenic
1038428597 8:27481731-27481753 ACTTGGAGCTGGATGGTCACTGG - Intergenic
1043231895 8:77813759-77813781 ATTTGGACATGGATCATTCCAGG - Intergenic
1047917857 8:129602470-129602492 ACGTGTACATGCATGTTTATAGG - Intergenic
1049944177 9:578729-578751 AATTGTACTTGGATGTTTATGGG + Intronic
1050146527 9:2573997-2574019 ATTTGGTCATTGATGTTTAATGG - Intergenic
1051507080 9:17839181-17839203 ATTTGGCCAAGGATGTTTGCTGG + Intergenic
1052128277 9:24807137-24807159 ACTTGTACTTGCATGTTTATTGG + Intergenic
1052264275 9:26553335-26553357 ACTTGAACATAGATGTGTACAGG + Intergenic
1052280705 9:26730056-26730078 ACATGCACATGTATGTTTATTGG - Intergenic
1052306822 9:27019730-27019752 ACTTGTACATGGATGTTTATAGG - Intronic
1055255502 9:74365299-74365321 ACATGCACATGTATGTTCACTGG - Intergenic
1055530721 9:77180168-77180190 ACTTGTACATGAATGTTCAGTGG - Intronic
1056745920 9:89302520-89302542 ACATGCACATGTATGTTTATTGG + Intergenic
1056923567 9:90813425-90813447 TCTTGGAACTGGATGTTTACAGG - Intronic
1057821036 9:98331199-98331221 ACATAGACATGAATGTTTATAGG - Intronic
1058949810 9:109893047-109893069 CCTTGGACCTGGATGCTTACCGG - Intronic
1059998264 9:119934695-119934717 CCTTGGACTTGGCTGTCTACAGG - Intergenic
1060356281 9:122911540-122911562 ACATGGAAATCTATGTTTACAGG + Exonic
1062075497 9:134586415-134586437 GCTGGGACATGGATGTTGGCGGG + Intergenic
1186218213 X:7322770-7322792 ATTTTGAGATGGATGTTCACAGG - Intronic
1186824843 X:13329161-13329183 AATTGTACCTGGATGTTTGCAGG - Intergenic
1187468500 X:19547194-19547216 ACTTGGTCATAGATGATCACTGG + Intronic
1187760740 X:22581246-22581268 ACATGCACACGTATGTTTACTGG + Intergenic
1188310237 X:28608025-28608047 ACATGGACCTGGATGCCTACTGG + Intronic
1188988191 X:36786738-36786760 ACTTGTACAAGAATGTTAACAGG + Intergenic
1190850095 X:54231769-54231791 ATTTGCACATGGACGTTTTCGGG + Intronic
1191995773 X:67093890-67093912 ACATGCACATGCATGTTTATAGG - Intergenic
1192687886 X:73325789-73325811 ACTTGCACATGCATGTATAGTGG - Intergenic
1193253072 X:79315937-79315959 ACTTGCACATGAATGTTTATAGG - Intergenic
1193695074 X:84698355-84698377 ACTTGGAGTTGGATGTTCAAGGG + Intergenic
1195297659 X:103495771-103495793 ACTTGTACCTGAATGTATACAGG - Intergenic
1195583721 X:106537681-106537703 TATTGGACTTGGATGTTTATAGG - Intergenic
1196414657 X:115458030-115458052 CCTGGGACATGGATGATGACGGG + Intergenic
1196964538 X:121041645-121041667 ACATGCACATGTATGTTTATTGG + Intergenic
1198914404 X:141651829-141651851 ACTTTGACATGGATATTTGAGGG + Intronic
1199225079 X:145363655-145363677 ACATGCACACGTATGTTTACTGG - Intergenic
1201602138 Y:15742800-15742822 ACATGCACATGTATGTTTATTGG - Intergenic