ID: 1100091694

View in Genome Browser
Species Human (GRCh38)
Location 12:90980134-90980156
Sequence AAATTGAGACAGATGTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2424
Summary {0: 1, 1: 0, 2: 3, 3: 148, 4: 2272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100091691_1100091694 2 Left 1100091691 12:90980109-90980131 CCAAAGGAGGCTCCAGGAAGAGC 0: 1
1: 0
2: 3
3: 22
4: 230
Right 1100091694 12:90980134-90980156 AAATTGAGACAGATGTTTCATGG 0: 1
1: 0
2: 3
3: 148
4: 2272
1100091693_1100091694 -10 Left 1100091693 12:90980121-90980143 CCAGGAAGAGCGGAAATTGAGAC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1100091694 12:90980134-90980156 AAATTGAGACAGATGTTTCATGG 0: 1
1: 0
2: 3
3: 148
4: 2272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100091694 Original CRISPR AAATTGAGACAGATGTTTCA TGG Intronic
Too many off-targets to display for this crispr