ID: 1100091694 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:90980134-90980156 |
| Sequence | AAATTGAGACAGATGTTTCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2424 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 148, 4: 2272} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100091691_1100091694 | 2 | Left | 1100091691 | 12:90980109-90980131 | CCAAAGGAGGCTCCAGGAAGAGC | 0: 1 1: 0 2: 3 3: 22 4: 230 |
||
| Right | 1100091694 | 12:90980134-90980156 | AAATTGAGACAGATGTTTCATGG | 0: 1 1: 0 2: 3 3: 148 4: 2272 |
||||
| 1100091693_1100091694 | -10 | Left | 1100091693 | 12:90980121-90980143 | CCAGGAAGAGCGGAAATTGAGAC | 0: 1 1: 0 2: 0 3: 12 4: 113 |
||
| Right | 1100091694 | 12:90980134-90980156 | AAATTGAGACAGATGTTTCATGG | 0: 1 1: 0 2: 3 3: 148 4: 2272 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100091694 | Original CRISPR | AAATTGAGACAGATGTTTCA TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||