ID: 1100092391

View in Genome Browser
Species Human (GRCh38)
Location 12:90986679-90986701
Sequence TAGGTTGGTACAGTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100092391_1100092398 20 Left 1100092391 12:90986679-90986701 CCAGCCAGCACTGTACCAACCTA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1100092398 12:90986722-90986744 AGTGCAAACCAGCAGCACATCGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100092391 Original CRISPR TAGGTTGGTACAGTGCTGGC TGG (reversed) Intronic
900591115 1:3460402-3460424 AAGGTTGAGACAGTGCAGGCTGG + Intronic
902261939 1:15232368-15232390 TAGGTAGGATCAGTGCTGACAGG - Intergenic
903007325 1:20307299-20307321 CAGGTTGGGACAGAGCTGGAAGG + Intronic
904246355 1:29190916-29190938 TAGGTGGGTACATGGCAGGCCGG - Intergenic
907423314 1:54362252-54362274 CAGGATGGTCCACTGCTGGCAGG - Intronic
910156547 1:84225480-84225502 TCCAGTGGTACAGTGCTGGCTGG - Intronic
911436075 1:97859552-97859574 TAGGGTGGTCCAGTGGTGGTGGG - Intronic
913568769 1:120099699-120099721 GAGGTAGGCAGAGTGCTGGCAGG - Intergenic
914289584 1:146260720-146260742 GAGGTAGGCAGAGTGCTGGCAGG - Intergenic
914550620 1:148711473-148711495 GAGGTAGGCAGAGTGCTGGCAGG - Intergenic
917276705 1:173338865-173338887 AAGGAAGTTACAGTGCTGGCTGG + Intergenic
918522658 1:185431675-185431697 TAGCTTGGAACAGTGTTGCCTGG + Intergenic
922777800 1:228224799-228224821 TAGGCTGGGACAGTGCTTGGCGG + Intronic
923761564 1:236849902-236849924 TAGGTTGTGACACTGCTGTCAGG + Intronic
924593805 1:245427970-245427992 CAGGCTGGCACAGTGTTGGCTGG - Intronic
1063327191 10:5116210-5116232 AAGGGAGGTACAGTGTTGGCTGG - Intronic
1065407815 10:25388939-25388961 TTGCTTGGGACAGTGCTGACAGG + Intronic
1067167122 10:43874103-43874125 GAGGCTGGTCCAGTGCTGGGAGG + Intergenic
1074749493 10:116570669-116570691 TAGGTTGGCAGAGGGCTGGATGG + Intergenic
1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG + Exonic
1082715454 11:56606521-56606543 AAGGGAGGTACAGTGTTGGCTGG + Intergenic
1084646519 11:70462018-70462040 TAGCTTGGCACTGTGCTGCCAGG - Intergenic
1085246709 11:75107823-75107845 TGGGTTTTTACAGTGCTGGTGGG + Intronic
1087990213 11:104740141-104740163 GGGGTTGGGAAAGTGCTGGCTGG + Intergenic
1090356018 11:126140791-126140813 GAGGTTAGTACAGGGCTGTCAGG + Intergenic
1091385966 12:94792-94814 TAGGCTGGCACAGTGGTGCCTGG - Intronic
1091550801 12:1533676-1533698 CTGTTTGGTACAGTTCTGGCTGG + Intronic
1095182146 12:39158610-39158632 TAGGAAGGCACAGTGATGGCTGG + Intergenic
1095925685 12:47576581-47576603 TAGGGAGGCACAGTGCTGCCAGG + Intergenic
1097843102 12:64341063-64341085 AAGGTAGTTACAGTGTTGGCTGG - Intronic
1100092391 12:90986679-90986701 TAGGTTGGTACAGTGCTGGCTGG - Intronic
1100172523 12:91991902-91991924 TGGGTTGTTACAGGGCAGGCTGG + Intronic
1100363073 12:93895546-93895568 TGGGATGGCACAGTGATGGCAGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102605750 12:114066059-114066081 TAGGTTGGGACAGAACTGGCTGG - Intergenic
1110815806 13:79858846-79858868 AAGGGAGTTACAGTGCTGGCTGG + Intergenic
1114396901 14:22371947-22371969 TTGATTGGGACAGAGCTGGCAGG - Intergenic
1119782015 14:77282170-77282192 TGGCTTGGTACAGTTCTGGCTGG - Intronic
1130439972 15:83943563-83943585 TAGATCGTTTCAGTGCTGGCAGG + Intronic
1131967000 15:97854927-97854949 AAGGGAGGTACTGTGCTGGCTGG + Intergenic
1133115181 16:3574448-3574470 GAGGGAGGGACAGTGCTGGCAGG + Intronic
1139910716 16:70395706-70395728 TTGGTTGGTACAGGTCTCGCTGG - Intronic
1144452363 17:15391566-15391588 CAGGATGGAACTGTGCTGGCTGG - Intergenic
1145916080 17:28574856-28574878 GAGGTTGGCACTGTGCTTGCAGG - Exonic
1148516751 17:48226061-48226083 TAGGTTGGGTCAGTGATGGATGG - Intronic
1149779960 17:59389485-59389507 TTGGTTGGTAGAGGGCTGGAAGG + Intronic
1154041277 18:10858797-10858819 TAGGTGGGTGGAGGGCTGGCTGG - Intronic
1156371352 18:36474300-36474322 TAAGTTGGTTCAGTGCCTGCAGG + Intronic
1157710322 18:49845757-49845779 TGGGTTGGTACAGAGCAGGGAGG + Intronic
1158117407 18:54011242-54011264 TTGATTGGAAAAGTGCTGGCTGG - Intergenic
1160610632 18:80082241-80082263 TGGGGTGGCACCGTGCTGGCAGG + Intronic
931469950 2:62529505-62529527 TTGAATGGTACAGTGCTGTCAGG + Intergenic
938169603 2:129063135-129063157 TAGGCTGCTACAATGATGGCTGG - Intergenic
941246370 2:163102590-163102612 TCAGCTGGTACAGTGATGGCTGG - Intergenic
948480598 2:238247838-238247860 TGAGGTGGCACAGTGCTGGCAGG + Intronic
1176070961 20:63226299-63226321 AGGGTTGCTCCAGTGCTGGCAGG + Intergenic
1176228529 20:64017867-64017889 GATGTTGGGACAGTGCTGTCAGG + Intronic
1183293417 22:37016587-37016609 TAGGTTGCTTCAGGGCAGGCTGG + Intronic
962344704 3:134610564-134610586 CAGGGAGATACAGTGCTGGCTGG + Intronic
962923213 3:139969561-139969583 CAGGTGGGTGCAGTGATGGCAGG - Intronic
970321488 4:14879785-14879807 TAGAATGCTGCAGTGCTGGCAGG + Intergenic
970557580 4:17250164-17250186 TAGGTTTCTACATTGTTGGCTGG - Intergenic
970941808 4:21642764-21642786 AAGGAAGTTACAGTGCTGGCTGG + Intronic
975947686 4:79727673-79727695 GAGGTTGGGAAAGTGTTGGCTGG - Intergenic
980822467 4:138035735-138035757 TAGCTGGGTCCAATGCTGGCAGG + Intergenic
982042496 4:151409463-151409485 CAGGTAGGTGCTGTGCTGGCCGG + Exonic
984014461 4:174409028-174409050 TAGGTTGGTGCTTTCCTGGCAGG - Intergenic
985520761 5:373134-373156 GCGGTTGGCAGAGTGCTGGCAGG + Intronic
986087365 5:4464574-4464596 AAGGGAGTTACAGTGCTGGCTGG + Intergenic
986147408 5:5091580-5091602 AAGGTAGTTACAGTGTTGGCTGG - Intergenic
990324664 5:54662765-54662787 TAGGTTGGGCTATTGCTGGCAGG + Intergenic
991033790 5:62107607-62107629 AAGGGTGTTACAGTGTTGGCTGG + Intergenic
993412349 5:87590131-87590153 AAGGGTGTTACAGTGTTGGCTGG - Intergenic
999532043 5:152474535-152474557 ATGCTTGGTACAGTGCTGGGGGG - Intergenic
1004402843 6:15304809-15304831 TGGGTGTGTCCAGTGCTGGCAGG + Intronic
1006494835 6:34414916-34414938 AAGGTAGGGACAGAGCTGGCAGG + Intronic
1008683151 6:53895601-53895623 TAGTTTAGTACAGTGCTTGTAGG + Intronic
1010741245 6:79507866-79507888 CAGGTTGGTCCAGTGGTGGTGGG - Intronic
1011463823 6:87634425-87634447 TAGGTTGGTACCATTCTGTCTGG + Intronic
1014455952 6:121635211-121635233 AAGGTAGTTACAGTGTTGGCTGG + Intergenic
1016840981 6:148525223-148525245 TGGGTTGGTGCACTGCCGGCTGG + Intronic
1021600073 7:22356471-22356493 GCGGTTGGGACAGGGCTGGCTGG + Intronic
1024210061 7:47195495-47195517 TAGGGTGGTAAAGTGCTGTGCGG + Intergenic
1029898452 7:104012029-104012051 TAGCTTGGCACAGTGCTGGGAGG - Intergenic
1031676770 7:124619964-124619986 AAGGTAGTTACAGTGTTGGCTGG + Intergenic
1033236736 7:139643972-139643994 TAGTCTGGTAGAGTGCTGGGAGG - Intronic
1036147163 8:6264644-6264666 TAAGATAGTACAGTGGTGGCCGG - Intergenic
1040450707 8:47543469-47543491 AAGGGTGGCACACTGCTGGCTGG + Intronic
1043365599 8:79529940-79529962 AATGCTGGTATAGTGCTGGCAGG + Intergenic
1044290675 8:90465344-90465366 CAGGTTGGAACAGGGCTGGATGG + Intergenic
1049240626 8:141535815-141535837 TGGGATGGGACAGGGCTGGCTGG + Intergenic
1049940855 9:544912-544934 TTGGTAGGTGAAGTGCTGGCTGG + Intronic
1050240213 9:3626648-3626670 TAGGATTCTCCAGTGCTGGCAGG + Intergenic
1050335725 9:4588464-4588486 TGGGATGGTACAGTCCTGCCTGG + Intronic
1051882189 9:21850955-21850977 AAGGGAGTTACAGTGCTGGCTGG + Intronic
1057210474 9:93198493-93198515 AAGGCTGGTCCAGGGCTGGCAGG - Intronic
1058020134 9:100077730-100077752 AAGGGAGGTACAGTGTTGGCTGG + Intronic
1058540757 9:106010308-106010330 AAGGGTGATACAGGGCTGGCTGG - Intergenic
1185639133 X:1577062-1577084 TAGGTGGGTACATTACTGGATGG + Intergenic
1185772462 X:2775004-2775026 AATGTTTGTACAGTGCTGGTGGG + Intronic
1186053560 X:5625705-5625727 TAGGTAGGTGCAGTGCCTGCAGG + Intergenic
1194179373 X:90694249-90694271 AAGGGAGGTACAGTGTTGGCTGG - Intergenic
1194838278 X:98708802-98708824 TACTGTGGTACAGAGCTGGCTGG - Intergenic
1199086173 X:143633543-143633565 TAGGTTTGTTCAGTCCTGGCTGG - Intronic
1199144228 X:144347288-144347310 AAGGGTGTTACAGTGTTGGCTGG - Intergenic
1200526039 Y:4276422-4276444 AAGGGAGGTACAGTGTTGGCTGG - Intergenic