ID: 1100097673

View in Genome Browser
Species Human (GRCh38)
Location 12:91062799-91062821
Sequence CTTGGTTAACACCACAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100097667_1100097673 25 Left 1100097667 12:91062751-91062773 CCCAGCTTCTCTGTCGGATTCCT 0: 1
1: 0
2: 1
3: 10
4: 177
Right 1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1100097671_1100097673 -6 Left 1100097671 12:91062782-91062804 CCACCATCTTGTGTTTTCTTGGT 0: 1
1: 0
2: 1
3: 29
4: 340
Right 1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1100097668_1100097673 24 Left 1100097668 12:91062752-91062774 CCAGCTTCTCTGTCGGATTCCTT 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1100097669_1100097673 5 Left 1100097669 12:91062771-91062793 CCTTGTTGCTTCCACCATCTTGT 0: 1
1: 0
2: 2
3: 20
4: 259
Right 1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1100097672_1100097673 -9 Left 1100097672 12:91062785-91062807 CCATCTTGTGTTTTCTTGGTTAA 0: 1
1: 1
2: 1
3: 36
4: 410
Right 1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100097673 Original CRISPR CTTGGTTAACACCACAATAT TGG Intergenic
902032822 1:13435261-13435283 CTCTGATGACACCACAATATAGG - Intergenic
902257889 1:15202472-15202494 ATGGGTTAACATCACAATGTGGG + Intronic
907179451 1:52556414-52556436 CTTGGTTAGGACCACATCATGGG - Intergenic
908903591 1:68983410-68983432 CTTTGTTAACTGCATAATATTGG - Intergenic
909546512 1:76854280-76854302 CATGGTTAATACGACTATATGGG - Intergenic
912815969 1:112828891-112828913 GGTGGTTAACAGCACAAGATAGG - Intergenic
913479319 1:119271384-119271406 CTTTGTTAACCCCAGAATCTGGG - Intergenic
921164274 1:212494954-212494976 CTTGCTTAACACAACTATAATGG - Intergenic
921403966 1:214758538-214758560 CTTGGTTAGCAGCAGAAAATAGG - Intergenic
1063235968 10:4116957-4116979 CTTGTTTTACACCACCACATGGG - Intergenic
1063832778 10:9974846-9974868 CTGGGTGAACAACAAAATATGGG + Intergenic
1072473311 10:95734223-95734245 CTTGGCTTACACCAGAATCTGGG - Intronic
1087264332 11:96044097-96044119 CTTGGTTAGCAACACAGTCTTGG - Intronic
1088933519 11:114376312-114376334 CTTTGTTTACACCACGATTTTGG - Intergenic
1090133869 11:124174681-124174703 CTTACATAACACCACAACATTGG + Intergenic
1098837369 12:75438982-75439004 CTTAGCCAACACCACAATTTGGG - Intergenic
1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG + Intergenic
1104339390 12:127933568-127933590 CTTGATCAACTCCACAATACTGG + Intergenic
1115987104 14:39113182-39113204 CTTGATTATCACCAAAATGTTGG + Intergenic
1116707044 14:48315663-48315685 CTTGGTGTACACCACCATGTTGG + Intergenic
1117939287 14:60944161-60944183 CTTTCTTAACACTACAAAATAGG - Intronic
1134836390 16:17364826-17364848 TTTGATTAACACCAGGATATCGG - Intronic
1138694104 16:58795528-58795550 CTTGGTTTAAACTACAAAATAGG - Intergenic
1139479902 16:67224752-67224774 CTTGGATAATAGGACAATATGGG - Intronic
1144428755 17:15171133-15171155 CTTTCCTACCACCACAATATTGG + Intergenic
1146274213 17:31505043-31505065 CTTAGTTAAGCCCACACTATAGG + Intronic
1147491433 17:40870954-40870976 CTTGGTAAAAACCTCCATATGGG - Intergenic
1153101907 18:1481483-1481505 ATAGCTTAATACCACAATATAGG - Intergenic
1156808150 18:41212479-41212501 GTAGGTTAACAAAACAATATGGG + Intergenic
1166427714 19:42694247-42694269 ATTGTTTAACAGCAAAATATTGG + Intronic
925246112 2:2384651-2384673 CTTGGCTGTCACCAGAATATTGG - Intergenic
929457581 2:42076887-42076909 GTTGGGTGACACCACAATAATGG + Intergenic
933301159 2:80542953-80542975 ATTGGTTAACACCATAACATTGG + Intronic
933525915 2:83438517-83438539 CTTGGCTGACACCACATTAGAGG - Intergenic
937729251 2:125207581-125207603 CTTGGTTAACCACAGGATATGGG - Intergenic
939848063 2:147271394-147271416 CTATGTTAAGACCCCAATATAGG - Intergenic
940398088 2:153216131-153216153 ATTGATTCACACAACAATATTGG - Intergenic
947053134 2:226069768-226069790 CATGGTTTTCAACACAATATTGG + Intergenic
1178852849 21:36227648-36227670 GTAGGTTAACCCCACAATGTTGG - Intronic
1182053097 22:27328205-27328227 CTTGGTTGCCACCCCACTATGGG + Intergenic
1184110721 22:42392622-42392644 CAGGGTTAACAGTACAATATTGG - Intronic
953577173 3:44122267-44122289 CGTGGGTAGAACCACAATATGGG + Intergenic
955100320 3:55842786-55842808 CTTGGTTAAAACCAAGAAATAGG - Intronic
955871810 3:63446981-63447003 CTTGGTTAACTCCTCAATTCTGG + Intronic
955964818 3:64378414-64378436 CTTGGTTAACATCCCATGATAGG - Intronic
959893375 3:111581299-111581321 CTTGGGTAACACCTCAAAATAGG - Intronic
960241706 3:115350204-115350226 ATTGATTAACACCACAGTTTAGG + Intergenic
960406280 3:117264154-117264176 CTTGATTAACAATAAAATATAGG + Intergenic
963999353 3:151750902-151750924 CTTTGTTATCACTACAATTTTGG - Intronic
964670670 3:159221755-159221777 CTAGGTTAAGCCCACCATATTGG - Intronic
965243815 3:166239331-166239353 CTTGGTTGATACCAAATTATTGG + Intergenic
970461492 4:16278769-16278791 TTTTGATAAAACCACAATATTGG + Intergenic
970797451 4:19930349-19930371 CACGGTTAAGACCATAATATAGG - Intergenic
971588401 4:28434630-28434652 CTTTGTTAACAGCACACAATTGG + Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
981223518 4:142264824-142264846 CTTAGTTACCTCCATAATATAGG - Intronic
988381415 5:30501300-30501322 CTTGTTTAAGGTCACAATATTGG + Intergenic
990556934 5:56945675-56945697 ATTTGTAAACACCAAAATATGGG + Intronic
993462212 5:88197173-88197195 CTTGAATAACACCACCACATGGG + Intronic
999645014 5:153708941-153708963 CTTGGTTAACCCCAGAGTTTAGG + Intronic
1000099659 5:158003102-158003124 CTTTGTTAAAACCTAAATATAGG + Intergenic
1001877185 5:175211707-175211729 TTTTCTTAACACTACAATATAGG + Intergenic
1002042164 5:176522286-176522308 CTTGTTTAAAACCAGAAAATTGG + Intergenic
1002392086 5:178922153-178922175 CTTGGAGAACTCCTCAATATTGG + Intronic
1010308053 6:74348283-74348305 CTTGGTGAGCTCCACAACATTGG - Intergenic
1014873948 6:126632353-126632375 CTTGGTTAATACTAAAATAATGG - Intergenic
1015180145 6:130352908-130352930 ATTGTTTAAAACCAAAATATTGG + Intronic
1015886970 6:137927538-137927560 CTTTGTGAAAACCACAAAATAGG + Intergenic
1022903954 7:34837920-34837942 CTTGGCTACCTCCACAAAATTGG - Intronic
1029698434 7:102229953-102229975 CCTGGTTAACACCACACTGGAGG - Intronic
1040511842 8:48102865-48102887 GTTGGTTAACATCAGAATATTGG + Intergenic
1046439014 8:114234530-114234552 ATTGATTAATACCAGAATATTGG + Intergenic
1046821789 8:118641982-118642004 CTCGGATAACTCAACAATATTGG + Intergenic
1051591780 9:18783418-18783440 CTTGTTTAACTCCAAATTATGGG - Intronic
1052099773 9:24431528-24431550 CTTTGTTAACACTCCAATAATGG + Intergenic
1056961715 9:91130663-91130685 TTTGGTGAACACCACAGTAATGG + Intergenic
1057498964 9:95581798-95581820 CTGGGTTAACAGCACAGTCTTGG + Intergenic
1186690133 X:11966621-11966643 CTTGGATAAAACCACATTTTGGG - Intergenic
1194026742 X:88762474-88762496 CTTGGATAACCACACAATAATGG - Intergenic
1194751502 X:97689802-97689824 CTTGGTTTACACCTCTATTTGGG - Intergenic
1199543518 X:148983599-148983621 CTTGGTTAGCACCACAGTTTTGG + Intronic