ID: 1100100243

View in Genome Browser
Species Human (GRCh38)
Location 12:91094739-91094761
Sequence CAGTGTGTTTGGAGAGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100100236_1100100243 22 Left 1100100236 12:91094694-91094716 CCGGAACAATGATATTTATTTGG No data
Right 1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG No data
1100100235_1100100243 23 Left 1100100235 12:91094693-91094715 CCCGGAACAATGATATTTATTTG No data
Right 1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100100243 Original CRISPR CAGTGTGTTTGGAGAGGAGT GGG Intergenic
No off target data available for this crispr