ID: 1100102574

View in Genome Browser
Species Human (GRCh38)
Location 12:91126706-91126728
Sequence CTGGGCAAACAGAAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100102567_1100102574 2 Left 1100102567 12:91126681-91126703 CCCAAAAGTGACGCTGCACACTA No data
Right 1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG No data
1100102568_1100102574 1 Left 1100102568 12:91126682-91126704 CCAAAAGTGACGCTGCACACTAG No data
Right 1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100102574 Original CRISPR CTGGGCAAACAGAAGAGGGA GGG Intergenic
No off target data available for this crispr