ID: 1100103868

View in Genome Browser
Species Human (GRCh38)
Location 12:91144383-91144405
Sequence GTTTCTATTGGAAGACATTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100103868_1100103872 4 Left 1100103868 12:91144383-91144405 CCTGAATGTCTTCCAATAGAAAC 0: 1
1: 0
2: 0
3: 21
4: 294
Right 1100103872 12:91144410-91144432 TATTCAACTGTAGTCATGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 100
1100103868_1100103874 16 Left 1100103868 12:91144383-91144405 CCTGAATGTCTTCCAATAGAAAC 0: 1
1: 0
2: 0
3: 21
4: 294
Right 1100103874 12:91144422-91144444 GTCATGAGAGGAGGATCTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 183
1100103868_1100103875 17 Left 1100103868 12:91144383-91144405 CCTGAATGTCTTCCAATAGAAAC 0: 1
1: 0
2: 0
3: 21
4: 294
Right 1100103875 12:91144423-91144445 TCATGAGAGGAGGATCTCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 171
1100103868_1100103873 7 Left 1100103868 12:91144383-91144405 CCTGAATGTCTTCCAATAGAAAC 0: 1
1: 0
2: 0
3: 21
4: 294
Right 1100103873 12:91144413-91144435 TCAACTGTAGTCATGAGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100103868 Original CRISPR GTTTCTATTGGAAGACATTC AGG (reversed) Exonic
900272274 1:1797237-1797259 GTTCCTATTGTGAGACATTTAGG - Intronic
900906187 1:5560905-5560927 GTTTCTCTTGGAAAACCATCAGG - Intergenic
905462245 1:38129394-38129416 GTTTCTAATGGAAAACAATATGG + Intergenic
906693075 1:47805567-47805589 GTCTCCATTAGCAGACATTCAGG + Intronic
912982302 1:114386666-114386688 CTTTGTTTTGGAAGACATTAGGG + Intergenic
913060807 1:115205791-115205813 GTTTGCAATGGAAAACATTCTGG - Intergenic
913935240 1:125034328-125034350 GTTTTTATATGAAGATATTCCGG - Intergenic
913935414 1:125037399-125037421 GTTTTTATGTGAAGATATTCCGG - Intergenic
913935507 1:125039103-125039125 GTTTTTATGTGAAGATATTCCGG - Intergenic
913935699 1:125041996-125042018 GTTTTTATGTGAAGATATTCCGG - Intergenic
915219305 1:154361578-154361600 GTTTTTATAAAAAGACATTCTGG + Intergenic
915848719 1:159297999-159298021 GTATCTGTTGGAAGACATGAAGG + Intronic
916313958 1:163427106-163427128 CTTTCCATTGGAAGAAATTAGGG - Intergenic
916404072 1:164480030-164480052 TGTTCTACTGGAAGACCTTCAGG - Intergenic
918598854 1:186328147-186328169 TCTTCTATAGGAAGACATTAAGG - Intronic
919099406 1:193075242-193075264 TCTTCTATTGGAAGAAATTGTGG + Intronic
923329915 1:232913529-232913551 GGTTCTGTTGGAGGACATTTGGG - Intergenic
924291301 1:242539305-242539327 GTTCCTATTTGCAGACCTTCAGG + Intergenic
1063025092 10:2170305-2170327 GTTTCCCTTGGAAAACATTCTGG + Intergenic
1063833231 10:9981047-9981069 GTTTCAATTATATGACATTCTGG + Intergenic
1066485684 10:35841860-35841882 GTTTCTTCTGGAAGAGATTGTGG + Intergenic
1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG + Intergenic
1066815138 10:39398127-39398149 GTTTTTATGTGAAGATATTCTGG - Intergenic
1067305999 10:45064690-45064712 GTATCTATTGCAATACATTCAGG - Intergenic
1070032356 10:72689569-72689591 TTCCCTATTGGAAGACATTGAGG + Intergenic
1073918660 10:108434016-108434038 GTTTCAATTAGGAGATATTCAGG - Intergenic
1075246804 10:120829824-120829846 GTTTCTTATGGAAAACTTTCAGG + Intergenic
1075599281 10:123755472-123755494 CATTCTAATGGAAGACTTTCTGG - Intronic
1080068386 11:28047125-28047147 TTTTCTATTGGAATATATGCTGG - Intronic
1080906022 11:36545678-36545700 TCTTCTATTGGCAGACATTTAGG + Intronic
1081205439 11:40269917-40269939 ATTTCTATTGGAATAAATGCAGG + Intronic
1082157521 11:48843920-48843942 GTTTTTATGTGAAGAAATTCCGG - Intergenic
1082164134 11:48923842-48923864 GTTTTTATGTGAAGATATTCTGG + Intergenic
1082607116 11:55252663-55252685 GTTTTTATGTGAAGATATTCCGG + Intergenic
1084796054 11:71504770-71504792 GGTTCTATTGGAACACAGCCAGG - Intronic
1085604323 11:77883595-77883617 GATTCTGTTGGAAGATATACAGG - Intronic
1086229478 11:84550951-84550973 CTTTCTATGGGAAGACACTCAGG + Intronic
1086562552 11:88184873-88184895 GTTTCTATTGAAAAATATTTAGG - Intergenic
1086856972 11:91877106-91877128 GTTTTTATTGGGAGTCAGTCTGG + Intergenic
1088057328 11:105600974-105600996 TTTTCTACTGGTAGACTTTCTGG - Intergenic
1090574563 11:128086759-128086781 GTTTCTCTTGCAAAACATCCAGG + Intergenic
1091955207 12:4635241-4635263 GTCTCTTTTGGAAGTCATACTGG + Intronic
1093107147 12:15100818-15100840 ATTTCTCTTGGAAGATATTTAGG + Intergenic
1094002515 12:25710634-25710656 GTTTATATTGAAAAACAATCTGG + Intergenic
1095056221 12:37605146-37605168 GTTTTTATTTGAAGATATTCCGG - Intergenic
1095056637 12:37613648-37613670 GTTTTTATGTGAAGATATTCTGG - Intergenic
1095056726 12:37615357-37615379 GTTTTTATGTGAAGATATTCCGG - Intergenic
1095056731 12:37615528-37615550 GTTTCTATGTGAAGATATTCTGG - Intergenic
1095080559 12:37994727-37994749 GTTTTTATCTGAAGATATTCAGG - Intergenic
1099041877 12:77666147-77666169 GTTGCTATTGGAAGCAATTAGGG - Intergenic
1100103868 12:91144383-91144405 GTTTCTATTGGAAGACATTCAGG - Exonic
1100815262 12:98380888-98380910 GTTGATATTGAAAGACAATCGGG + Intergenic
1101529542 12:105561607-105561629 AATTCCTTTGGAAGACATTCTGG - Intergenic
1101869232 12:108549433-108549455 GTTCCTGTTAGAAGACATTTGGG + Intronic
1104369914 12:128215442-128215464 CTTTATATTGGAAGACAGTGCGG - Intergenic
1105098456 13:16411451-16411473 GATTTTATAGGAAGATATTCCGG - Intergenic
1105124216 13:16832201-16832223 GATTTTATAGGAAGATATTCCGG - Intergenic
1105131468 13:16950720-16950742 GATTTTATAGGAAGATATTCCGG - Intergenic
1105131714 13:16954814-16954836 GATTTTATAGGAAGATATTCCGG - Intergenic
1105294890 13:19079353-19079375 GTTTCTATTGGCATATCTTCAGG - Intergenic
1105745855 13:23376199-23376221 GTTGTGATGGGAAGACATTCAGG - Intronic
1106311691 13:28560378-28560400 ATTTCTATCCAAAGACATTCAGG + Intergenic
1106384605 13:29271727-29271749 GTGTCTATTTGCAGAAATTCAGG - Intronic
1107668167 13:42714628-42714650 GTTTCATTTGTATGACATTCTGG - Intergenic
1108103563 13:46984050-46984072 GTATCTCTAGGAAGGCATTCAGG + Intergenic
1109724531 13:66322171-66322193 CTTTCTATGAGAATACATTCTGG + Intronic
1110837322 13:80099066-80099088 TTTTCTACTGATAGACATTCAGG + Intergenic
1110905494 13:80882466-80882488 GTTGCCATTAGAAGACATGCTGG - Intergenic
1112724278 13:102284217-102284239 GTTGCGATTTGGAGACATTCTGG - Intronic
1114890152 14:26910215-26910237 GTTTCTATCTAATGACATTCTGG + Intergenic
1115840637 14:37466097-37466119 ATTTCTGTTGCAAGACACTCTGG - Intronic
1116263807 14:42662621-42662643 CTTTCTATTGGGAGACTTTAAGG + Intergenic
1116599240 14:46898235-46898257 GTTTATTTTGGAAGAGACTCTGG + Intronic
1118338813 14:64878633-64878655 GTTTCTAAGGGAAGAGATTCAGG - Intronic
1118611779 14:67547103-67547125 ATTTCCATGTGAAGACATTCTGG - Intronic
1121903387 14:97715662-97715684 TTTTCTATTGAAAGACATCTGGG + Intergenic
1122766259 14:104072980-104073002 GTTTCTTTTGGAAGTCAATCTGG + Intergenic
1124923151 15:34046167-34046189 GTTTATTGTGGAAAACATTCAGG + Intronic
1131445384 15:92494513-92494535 CTTTCTCTTGGAAGTGATTCAGG - Intronic
1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG + Exonic
1133872881 16:9705902-9705924 GTTTCTAAAGGCAGAAATTCAGG + Intergenic
1135947527 16:26877924-26877946 GTTTCTAGATGAAGACATTGAGG + Intergenic
1136918574 16:34241119-34241141 GTTTATATGTGAAGATATTCCGG - Intergenic
1137805255 16:51298590-51298612 GTTTCAATGGGTAAACATTCTGG + Intergenic
1140019118 16:71220145-71220167 GTTTTAATTGGTACACATTCGGG - Intronic
1140133096 16:72181315-72181337 CATTTTATTGGAAGACATTTTGG + Intergenic
1140941748 16:79727950-79727972 TTTTCTATTGGAGGACATTTAGG + Intergenic
1143907944 17:10224798-10224820 CTTTCTCTTGGAAGACTTTCTGG + Intergenic
1144759219 17:17698023-17698045 AGTTCTACTGGAAGACAGTCAGG - Intronic
1145724755 17:27108387-27108409 GTTTCTAAGGGAAAACATTGAGG + Intergenic
1153478472 18:5522718-5522740 GTTGCTCTTGGAAGCCATTCTGG + Intronic
1155581617 18:27314550-27314572 TTTTCTCTTGGAAGATATTTGGG + Intergenic
1156397388 18:36710493-36710515 AGGTCTATTGGAAGACATTCTGG - Intronic
1158582041 18:58692101-58692123 GTTTCCAGTGGGAGACATCCAGG + Intronic
1160084612 18:75764279-75764301 GTTTGTATTGGAAAATATTAGGG + Intergenic
1163984466 19:20932021-20932043 CTTTATAATGGAAGAGATTCAGG - Intronic
1164373832 19:27667922-27667944 GTTTTTATTGCAGGACATTTGGG + Intergenic
1164386097 19:27771578-27771600 GATTCTAATAGAAGACACTCTGG - Intergenic
1164851753 19:31489934-31489956 GTTTCTATGGCAAAACACTCTGG + Intergenic
1165532080 19:36411634-36411656 TTTTCTATTGAAGGACATTTAGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1168167836 19:54564748-54564770 GTTTCTACTGGATGCCATTTAGG + Intergenic
925674877 2:6351570-6351592 GTTTCTTTTTCAAGACATCCAGG - Intergenic
926780831 2:16470475-16470497 GTATATATTGTATGACATTCTGG + Intergenic
927045677 2:19275862-19275884 GGTTCTATTGTAGGACCTTCTGG + Intergenic
927390003 2:22583862-22583884 GGTTCTTTAGAAAGACATTCTGG - Intergenic
927988193 2:27428545-27428567 GTTTCCATTGGGTGACGTTCTGG - Exonic
930521741 2:52476084-52476106 GTTTCTATAGAAGCACATTCTGG + Intergenic
932313451 2:70763198-70763220 GTTTATCTTGGAAGACAGACCGG + Intronic
935529521 2:104215721-104215743 GTTTCTAATGGCAGGCATTTTGG - Intergenic
936912962 2:117611680-117611702 GTTTCTCCTAGAAGACACTCTGG - Intergenic
939320474 2:140613947-140613969 GTTTCTAATGGATGGCTTTCAGG - Intronic
941755482 2:169181325-169181347 CTGTCTGTTGGAAGTCATTCGGG - Intronic
942915612 2:181302782-181302804 GTTTCTGTTGAAAGACCTACTGG - Intergenic
1169644718 20:7797183-7797205 GTTTCAATTAGAGGCCATTCTGG - Intergenic
1174869701 20:54171624-54171646 GTTTCTTTTGAAAGGCACTCCGG + Exonic
1178148254 21:29764523-29764545 GTTTCCTTTGAATGACATTCAGG - Intronic
1180508091 22:16038990-16039012 GTTTTTATATGAAGATATTCAGG + Intergenic
1180508128 22:16039674-16039696 GTTTTTATGTGAAGATATTCCGG + Intergenic
1182425979 22:30272835-30272857 TTTTCTATTGACAGACATTTGGG - Intergenic
1184199360 22:42955426-42955448 GCTTTTATTGGTAGACATGCAGG - Intronic
1184521577 22:44997696-44997718 GTTTCTCTTTGATGTCATTCAGG - Intronic
949455787 3:4236963-4236985 ATTTCTATTATATGACATTCTGG - Intronic
949731226 3:7115632-7115654 ACTTCTATGGGAAGTCATTCAGG + Intronic
950661765 3:14471284-14471306 GTCTCTGATGGGAGACATTCCGG - Intronic
951306779 3:21073618-21073640 GATTCTTTTGGAAGACAAACAGG + Intergenic
951946631 3:28144474-28144496 TTTTCTGTTGGAAGACATGGTGG + Intergenic
957161433 3:76615047-76615069 TTTCCTATTGGTAGAAATTCCGG - Intronic
958004708 3:87796072-87796094 GTTTCTGTTGGAAGACAAGAAGG + Intergenic
958206379 3:90401579-90401601 GTTTTTATGTGAAGATATTCCGG + Intergenic
958207093 3:90415548-90415570 GTTTTTATGTGAAGATATTCCGG + Intergenic
958209437 3:90451284-90451306 ATTTGTATTTGAGGACATTCTGG + Intergenic
958404273 3:93732307-93732329 CTTTATATTTGAAGATATTCTGG + Intergenic
958591336 3:96162274-96162296 GTTTCTATGGGTCCACATTCTGG - Intergenic
960002265 3:112745201-112745223 GTTACTCTGGGAAGACATTCTGG - Intronic
960522801 3:118675130-118675152 GTTTCTGCTTGAAGACAGTCAGG - Intergenic
963607474 3:147423513-147423535 TTTTCTCTTGGAATAAATTCGGG - Intronic
965088964 3:164138528-164138550 ACTTCTATTGGAAGATCTTCAGG + Intergenic
965552392 3:169980993-169981015 ATTTTTTTTGTAAGACATTCTGG + Intronic
970622636 4:17839813-17839835 GGTTCTATTGAATGAGATTCTGG + Exonic
972229321 4:37053095-37053117 GTGTGTATTGGAAGACATGAAGG - Intergenic
972310204 4:37874430-37874452 GTTACTATTGGATAACATTCTGG + Intergenic
972918672 4:43910346-43910368 GTTTGTATTGGAAGACTTATGGG - Intergenic
973405893 4:49735509-49735531 GATTTTATAGGAAGATATTCCGG - Intergenic
973407075 4:49754735-49754757 GATTTTATAGGAAGATATTCCGG - Intergenic
973408060 4:49770891-49770913 GATTTTATAGGAAGATATTCCGG - Intergenic
973408452 4:49777356-49777378 GATTTTATAGGAAGATATTCCGG - Intergenic
973410835 4:49816804-49816826 GATTTTATAGGAAGATATTCCGG - Intergenic
973411939 4:49835003-49835025 GATTTTATAGGAAGATATTCCGG - Intergenic
973414793 4:49881931-49881953 GATTTTATAGGAAGATATTCCGG - Intergenic
973417994 4:49934789-49934811 GATTTTATAGGAAGATATTCCGG - Intergenic
973420084 4:49969456-49969478 GATTTTATAGGAAGATATTCCGG - Intergenic
973423768 4:50030324-50030346 GATTTTATAGGAAGATATTCCGG - Intergenic
973425929 4:50066027-50066049 GATTTTATAGGAAGATATTCCGG - Intergenic
973426125 4:50069255-50069277 GATTTTATAGGAAGATATTCCGG - Intergenic
973428024 4:50100891-50100913 GATTTTATAGGAAGATATTCCGG - Intergenic
973428222 4:50104122-50104144 GATTTTATAGGAAGATATTCCGG - Intergenic
973428422 4:50107354-50107376 GATTTTATAGGAAGATATTCCGG - Intergenic
973430291 4:50138301-50138323 GATTTTATAGGAAGATATTCCGG - Intergenic
973430684 4:50144765-50144787 GATTTTATAGGAAGATATTCCGG - Intergenic
973432664 4:50177585-50177607 GATTTTATAGGAAGATATTCCGG - Intergenic
973433533 4:50192377-50192399 GATTTTATAGGAAGATATTCCGG - Intergenic
973436470 4:50240669-50240691 GATTTTATAGGAAGATATTCCGG - Intergenic
973438836 4:50279935-50279957 GATTTTATAGGAAGATATTCCGG - Intergenic
973441290 4:50320248-50320270 GATTTTATAGGAAGATATTCCGG - Intergenic
973443687 4:50359695-50359717 GATTTTATAGGAAGATATTCCGG - Intergenic
973444277 4:50369386-50369408 GATTTTATAGGAAGATATTCCGG - Intergenic
973446352 4:50404405-50404427 GATTTTATAGGAAGATATTCCGG - Intergenic
973449056 4:50449286-50449308 GATTTTATAGGAAGATATTCCGG - Intergenic
973450152 4:50467314-50467336 GATTTTATAGGAAGATATTCCGG - Intergenic
973452983 4:50514228-50514250 GATTTTATAGGAAGATATTCCGG - Intergenic
973456555 4:50573228-50573250 GATTTTATAGGAAGATATTCCGG - Intergenic
973457239 4:50584451-50584473 GATTTTATAGGAAGATATTCCGG - Intergenic
973457440 4:50587681-50587703 GATTTTATAGGAAGATATTCCGG - Intergenic
973457868 4:50594653-50594675 GATTTTATAGGAAGATATTCCGG - Intergenic
973458617 4:50606902-50606924 GATTTTATAGGAAGATATTCCGG - Intergenic
973463965 4:50694823-50694845 GATTTTATAGGAAGATATTCCGG - Intergenic
973464478 4:50703160-50703182 GATTTTATAGGAAGATATTCCGG - Intergenic
973465450 4:50719145-50719167 GATTTTATAGGAAGATATTCCGG - Intergenic
973465846 4:50725606-50725628 GATTTTATAGGAAGATATTCCGG - Intergenic
973469820 4:50791205-50791227 GATTTTATAGGAAGATATTCCGG - Intergenic
973470411 4:50800897-50800919 GATTTTATAGGAAGATATTCCGG - Intergenic
973473151 4:50846135-50846157 GATTTTATAGGAAGATATTCCGG - Intergenic
973476305 4:50898313-50898335 GATTTTATAGGAAGATATTCCGG - Intergenic
973479058 4:50944043-50944065 GATTTTATAGGAAGATATTCCGG - Intergenic
973480541 4:50968527-50968549 GATTTTATAGGAAGATATTCCGG - Intergenic
973485594 4:51052189-51052211 GATTTTATAGGAAGATATTCCGG - Intergenic
973485794 4:51055419-51055441 GATTTTATAGGAAGATATTCCGG - Intergenic
973486338 4:51064435-51064457 GATTTTATAGGAAGATATTCCGG - Intergenic
973497705 4:51251713-51251735 GATTTTATAGGAAGATATTCCGG - Intergenic
973504195 4:51358998-51359020 GATTTTATAGGAAGATATTCCGG - Intergenic
973504788 4:51368690-51368712 GATTTTATAGGAAGATATTCCGG - Intergenic
973506948 4:51403900-51403922 GATTTTATAGGAAGATATTCCGG - Intergenic
973509830 4:51451525-51451547 GATTTTATAGGAAGATATTCCGG - Intergenic
973510993 4:51470745-51470767 GATTTTATAGGAAGATATTCCGG - Intergenic
973512394 4:51494050-51494072 GATTTTATAGGAAGATATTCCGG - Intergenic
973513209 4:51507142-51507164 GATTTTATAGGAAGATATTCCGG - Intergenic
973513807 4:51516838-51516860 GATTTTATAGGAAGATATTCCGG - Intergenic
973518432 4:51592870-51592892 GATTTTATAGGAAGATATTCCGG - Intergenic
973519123 4:51604263-51604285 GATTTTATAGGAAGATATTCCGG - Intergenic
973520724 4:51630448-51630470 GATTTTATAGGAAGATATTCCGG - Intergenic
973522543 4:51660399-51660421 GATTTTATAGGAAGATATTCCGG - Intergenic
973522938 4:51666868-51666890 GATTTTATAGGAAGATATTCCGG - Intergenic
973525491 4:51708537-51708559 GATTTTATAGGAAGATATTCCGG - Intergenic
973525969 4:51716360-51716382 GATTTTATAGGAAGATATTCCGG - Intergenic
977047635 4:92087939-92087961 GATAATTTTGGAAGACATTCAGG + Intergenic
979157819 4:117419944-117419966 GGTTCTATTGGAAAAGTTTCTGG - Intergenic
979832827 4:125321452-125321474 TTTACTATTGGACGACATACTGG + Exonic
981479039 4:145217546-145217568 GTTTCATTTGGAAGACAATGTGG - Intergenic
982023635 4:151230380-151230402 GAATCTGTTGTAAGACATTCAGG + Intronic
982626140 4:157768631-157768653 GTTTCTATTAGACTACATTATGG + Intergenic
986553202 5:8981704-8981726 GTTTATATTGGCAGACACCCTGG - Intergenic
986991325 5:13556466-13556488 GTTTCTGTTTGAAGACACTTGGG - Intergenic
988224887 5:28400348-28400370 GTTTCTATTCCAAGACTGTCTGG + Intergenic
988955477 5:36312230-36312252 CTTTCTATTGGAATTCTTTCTGG + Intergenic
989748381 5:44860214-44860236 ATTACTATTGGAAAACATGCAGG + Intergenic
989913134 5:49684716-49684738 CTTTTTATGTGAAGACATTCCGG - Intergenic
989913483 5:49690335-49690357 CTTTTTATGTGAAGACATTCCGG - Intergenic
989914428 5:49704815-49704837 CTTTCTATGTGAAGATATTCCGG - Intergenic
989917008 5:49744269-49744291 GTTTTTATTAGAAGATATTCCGG - Intergenic
989919089 5:49775285-49775307 CTTTCTATGTGAAGATATTCCGG - Intergenic
989924342 5:49852631-49852653 CTTTCTATGTGAAGATATTCCGG - Intergenic
991334839 5:65535541-65535563 GTTTTTATTGGGAGTCAGTCAGG - Intronic
993620175 5:90158907-90158929 TTTTGTATTGGAAGAACTTCAGG - Intergenic
993853998 5:93049610-93049632 GTTTCTTTTGAAAGATATTAAGG + Intergenic
995639797 5:114242514-114242536 CATTCTTTTGGTAGACATTCAGG - Intergenic
995725204 5:115174555-115174577 GTTTCTATGGGAACAAAGTCAGG + Intronic
996325968 5:122274179-122274201 GTTTCCATTTGAAGTGATTCTGG - Intergenic
997289631 5:132719041-132719063 GTTTCTAATTTTAGACATTCTGG - Intronic
997388163 5:133490173-133490195 ACTTCTATTGTAGGACATTCCGG - Intronic
999617444 5:153439288-153439310 GCTGCTATTGGAAGACATCTAGG + Intergenic
1202771715 5_GL000208v1_random:8827-8849 GTTTTTATTTGAATATATTCCGG + Intergenic
1202774519 5_GL000208v1_random:55687-55709 GTTTTTATGTGAAGATATTCCGG + Intergenic
1202776218 5_GL000208v1_random:76495-76517 CTTTTTATGTGAAGACATTCCGG + Intergenic
1202776472 5_GL000208v1_random:80922-80944 CTTTTTATGTGAAGACATTCCGG + Intergenic
1003284058 6:4718877-4718899 GGTTATATTGATAGACATTCAGG + Intronic
1003462308 6:6341214-6341236 GTGACCATTGGAAGACATTCAGG - Intergenic
1004272698 6:14210000-14210022 GTTTCTATTTAAACTCATTCAGG - Intergenic
1004771323 6:18785849-18785871 ATTTCTACTGTATGACATTCTGG - Intergenic
1007287606 6:40758795-40758817 GCTTCTCTTGGAAGAGTTTCTGG + Intergenic
1009255135 6:61380760-61380782 GTTTTTATATGAAGAAATTCTGG - Intergenic
1009255694 6:61393275-61393297 GTTTTTATATGAAGAAATTCTGG - Intergenic
1009479920 6:64143893-64143915 TTTTCTTTTGGAAGTCATTGGGG + Intronic
1009695012 6:67091232-67091254 TTTTTTCTTGGAAGCCATTCAGG - Intergenic
1012195733 6:96339647-96339669 GTTTCTATTGTACTACCTTCAGG + Intergenic
1012577610 6:100822213-100822235 TTTTCTATTGTAAGTCATTTTGG - Intronic
1013162534 6:107559880-107559902 ATTTCTATTGCAAGTCACTCAGG - Intronic
1014499891 6:122173700-122173722 CATTCTATTGGTAGACATTTGGG + Intergenic
1015625399 6:135176603-135176625 GTTTCTTATGGAAGACATCCGGG - Intergenic
1016432778 6:144005705-144005727 ATTTATATTGGAAAACATTCTGG - Intronic
1017830414 6:158122957-158122979 ATTCCTATTGGCAGACATTTAGG + Intronic
1018581800 6:165314301-165314323 TTTTCTCTTGGAAATCATTCCGG + Intergenic
1020430109 7:8109956-8109978 GTTTCCAGTGGAGGACTTTCAGG - Intergenic
1021088221 7:16449464-16449486 GTATCTTTTGGAGGATATTCTGG - Intergenic
1021869390 7:24988872-24988894 GTTTCTTTTGCAAGAAATACTGG - Intergenic
1022955372 7:35375414-35375436 GTTGCTAATGTAACACATTCAGG + Intergenic
1024406336 7:48985747-48985769 GTTTTTAATGGTAGCCATTCTGG + Intergenic
1024534133 7:50416118-50416140 GTTTCTCTGAGAAGACAATCAGG - Intergenic
1024550553 7:50559365-50559387 ATTTCTGGAGGAAGACATTCAGG - Intronic
1024721509 7:52142162-52142184 GTTCCAATTGCATGACATTCTGG + Intergenic
1025309697 7:57916679-57916701 GTTTTTATGTGAAGATATTCTGG - Intergenic
1025315266 7:58016391-58016413 GTTTTTATGTGAAGATATTCTGG - Intergenic
1026173649 7:67976636-67976658 GTTTCTCCTGGAAGTCACTCAGG + Intergenic
1026216365 7:68353004-68353026 GTTTCTATTTGCATACATTAAGG - Intergenic
1027047680 7:75001963-75001985 ATGTCTATTGGATGACTTTCAGG - Intronic
1030811997 7:113984452-113984474 GCTTCTATTTGAATACATTAAGG + Intronic
1030953703 7:115824352-115824374 GTTACTATTGGTGGACATTTTGG - Intergenic
1032360916 7:131253722-131253744 GTTCCTTTTGGAAGAGCTTCAGG - Intronic
1032837385 7:135686717-135686739 GTTGCTAGTGGAATAAATTCAGG - Intronic
1033468405 7:141620098-141620120 GATTCTATTTTATGACATTCTGG + Intronic
1033551874 7:142455005-142455027 ATTTCTATTAGAACACATTTGGG - Intergenic
1033865658 7:145687597-145687619 TTTTCCTTTGGAAGACATTTTGG + Intergenic
1034583601 7:152068244-152068266 CTTTCCATTGTATGACATTCTGG - Intronic
1035045019 7:155959881-155959903 ATTTGTATTGGAAGACACGCTGG - Intergenic
1037468045 8:19179422-19179444 GTTTTTCTTGGAAGAGATTACGG + Intergenic
1038234897 8:25743230-25743252 TTTTGTAGAGGAAGACATTCAGG - Intergenic
1039009795 8:33080635-33080657 GTTTCAATTAGAATAAATTCTGG - Intergenic
1040281621 8:46054305-46054327 GTTTTTATTGTGAGATATTCAGG - Intergenic
1040753472 8:50740443-50740465 GTTTCTAATGGTAGCCATTCTGG - Intronic
1042069054 8:64910714-64910736 GTTTTTATGGGAAAACATTAAGG - Intergenic
1043099931 8:76031132-76031154 GTTTCTATAGCATGACAATCAGG - Intergenic
1046027355 8:108740903-108740925 GTTTGTATTGGAAGAAAAGCTGG + Intronic
1046031122 8:108785129-108785151 GTTGCTATTGGCAGACTTTCCGG - Exonic
1047399256 8:124532251-124532273 GTTTCTCTTAGATGCCATTCAGG - Intronic
1048672356 8:136737114-136737136 GTTTCTGTTGGAAGAAACACAGG + Intergenic
1049841268 8:144774166-144774188 GTTACTGTGGGAAAACATTCAGG - Exonic
1050771823 9:9211099-9211121 GTTTGTGTTGGAGTACATTCTGG + Intronic
1051981090 9:23017996-23018018 GTTCCAACTGTAAGACATTCTGG - Intergenic
1052011378 9:23413751-23413773 GTTTCTGTGGGAAGTCATTGGGG - Intergenic
1052319176 9:27149552-27149574 GTCTATAATGGAAGAAATTCAGG - Intronic
1052580152 9:30344940-30344962 TTTGCTATTGGAAGATTTTCAGG - Intergenic
1054877790 9:70114536-70114558 GTTTCTTTTACAATACATTCAGG + Intronic
1055740736 9:79386035-79386057 ATTTTTATTGGATGACATTAAGG + Intergenic
1057264941 9:93610326-93610348 GTTTCTATTGGCATATCTTCAGG + Intronic
1057956768 9:99415814-99415836 GTTTTTACTGGAAGACTTCCAGG - Intergenic
1059006510 9:110408281-110408303 CATTCTACTGGAACACATTCTGG + Exonic
1203418283 Un_KI270366v1:6449-6471 GTTTTTATGTGAAGATATTCCGG + Intergenic
1185823881 X:3230478-3230500 GTTTATATTTGGAGATATTCAGG + Intergenic
1186673376 X:11790235-11790257 GTTTCTGTTGGTAGACACTAGGG + Intergenic
1187306463 X:18099470-18099492 GTATCTCTTGGAAGAGCTTCTGG - Intergenic
1188753499 X:33932488-33932510 GTTTCCATAGGATGAGATTCAGG + Intergenic
1189115463 X:38337745-38337767 GTTTATAATGGAAAAAATTCAGG - Intronic
1189568603 X:42271395-42271417 GTTGCCATTGGAAGACAGTGGGG + Intergenic
1190802953 X:53809170-53809192 TTTTCTTTTGGAAGAGTTTCAGG - Intergenic
1191230731 X:58091511-58091533 CCTTCTAATGGAAGAGATTCCGG + Intergenic
1191240165 X:58182294-58182316 GTTTCTATTGCAGGATATTTGGG - Intergenic
1191570566 X:62611495-62611517 GTTTTTATGTGAAGATATTCCGG - Intergenic
1191582095 X:62774619-62774641 GTTTTTATTGGAGGATATTCAGG + Intergenic
1191584159 X:62802114-62802136 GTTTTTATTGCAGGATATTCTGG + Intergenic
1193268437 X:79501015-79501037 TTATCTATTGGTAGACATTTAGG - Intergenic
1194808100 X:98355504-98355526 GTTTCAATTATATGACATTCTGG + Intergenic
1194845078 X:98795900-98795922 GTTGCTATTGAAACACACTCAGG + Intergenic
1194896316 X:99445527-99445549 ATTTCTTTAAGAAGACATTCAGG - Intergenic
1195137872 X:101928784-101928806 TTTTAGATTGGAAGACCTTCTGG - Intronic
1195950554 X:110267640-110267662 GTTTCTCATGGAAGTCATTGAGG - Intronic
1197786870 X:130207262-130207284 TTTTCATTTGGAAGACATTGGGG - Intronic