ID: 1100104990

View in Genome Browser
Species Human (GRCh38)
Location 12:91159215-91159237
Sequence ATGTTCATGATCAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100104990_1100104992 -5 Left 1100104990 12:91159215-91159237 CCATCTTCATTGATCATGAACAT 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1100104992 12:91159233-91159255 AACATGGATTCCGCTACAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100104990 Original CRISPR ATGTTCATGATCAATGAAGA TGG (reversed) Intronic
904586432 1:31583540-31583562 ATGTTCATGACCGAGGAAGATGG - Exonic
905811332 1:40915565-40915587 CTGTTTATGTTCAATGAAGTAGG - Intergenic
907313371 1:53552450-53552472 ATTTTCATCATCAATGAGCAGGG - Intronic
910914729 1:92276848-92276870 ATGTTCATAATTATTGAAGCTGG + Intronic
911352153 1:96766346-96766368 ATGTTTATGTTCAGTTAAGAAGG - Intronic
911380660 1:97110053-97110075 AAGTTCATGGCCAATGTAGAGGG - Intronic
914340366 1:146754822-146754844 ATGGTCATGATAAATTAAAAGGG + Intergenic
917653416 1:177101839-177101861 AGTTTCATAATCAATGATGAGGG - Intronic
918288280 1:183080332-183080354 ATGTAGATAATCAATGATGAAGG - Intronic
919262537 1:195215981-195216003 CTGCTCATTATCAATGATGAAGG - Intergenic
919297028 1:195715457-195715479 AAGTTCATGCTAACTGAAGATGG - Intergenic
919572886 1:199270420-199270442 AGGTTTAGGTTCAATGAAGAAGG - Intergenic
1063290299 10:4738816-4738838 TTGTTCATGATCAATGTTAAGGG - Intergenic
1063644942 10:7870232-7870254 AATTTCATGCTCAAAGAAGAAGG - Intronic
1064307622 10:14182167-14182189 ATGATAGTGATCAATGGAGATGG + Intronic
1064822423 10:19352700-19352722 ATGCTCATGGTCCATGAAGAAGG - Intronic
1065227133 10:23555757-23555779 ATGTTTGTGAGAAATGAAGATGG + Intergenic
1068082287 10:52334227-52334249 ATGCATATGATCAATCAAGATGG - Intergenic
1069199456 10:65594475-65594497 ATGTTAATTATCCATGGAGAAGG - Intergenic
1070203738 10:74234256-74234278 ATGTTAAAGAACAAGGAAGAAGG + Intronic
1071110685 10:82151660-82151682 CTGGTCTTGATGAATGAAGAAGG + Intronic
1071127985 10:82357715-82357737 ATGTTGATGATATTTGAAGATGG - Intronic
1071717296 10:88110310-88110332 ATGTCCATTATCCAAGAAGAAGG + Intergenic
1075357795 10:121798095-121798117 ATGTTAATGAGCAAGGCAGAAGG - Intronic
1078917931 11:15797822-15797844 CTGTTCATGATCAATGCAAAGGG + Intergenic
1080429354 11:32184375-32184397 ATTCTCAGGAGCAATGAAGAAGG + Intergenic
1080962555 11:37177614-37177636 ATTTTGTTAATCAATGAAGAGGG - Intergenic
1081022695 11:37967686-37967708 ATGTTCAGTATCAGTGAAGCAGG + Intergenic
1081683332 11:45024150-45024172 ATGATCATGAACAAAGCAGAGGG - Intergenic
1084753759 11:71221886-71221908 ATGTTCATGATCAATGAATGGGG + Intronic
1086371146 11:86156902-86156924 ATGTTGATCATCAATGATCAAGG + Intergenic
1086600659 11:88629512-88629534 TTGTCCGTGATCAATAAAGAAGG - Intronic
1087562877 11:99814130-99814152 ATGTCCTTGAACAGTGAAGATGG + Intronic
1090041309 11:123294674-123294696 ATGTTGATAATCACTGAAGCTGG + Intergenic
1093954848 12:25203944-25203966 ATTTACATGATAAATGAAAATGG + Exonic
1095926022 12:47579963-47579985 ATGTTCATGGACGAAGAAGAAGG + Intergenic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1097702022 12:62829938-62829960 GTGTTCATGATCATTGAATAGGG - Intronic
1100104990 12:91159215-91159237 ATGTTCATGATCAATGAAGATGG - Intronic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1104549135 12:129739846-129739868 ATGTTAATTACCAATGGAGAAGG - Intronic
1106443063 13:29797293-29797315 ATGTTCATGGTCAAAGAAGCAGG + Intronic
1106658242 13:31770520-31770542 GTGTTCTGGATCAAAGAAGATGG - Intronic
1107882104 13:44841763-44841785 ATGAGTATGATCAATGAAGGGGG - Intergenic
1108387744 13:49916745-49916767 ATGTTTATAAGCACTGAAGAGGG + Intronic
1108820146 13:54339109-54339131 ATGTTCTTGATTAATTAAAAAGG + Intergenic
1108840991 13:54614702-54614724 ATGGACATGATCTATGAAGATGG - Intergenic
1109057896 13:57575770-57575792 ATGCTCATGACTAATGAATAGGG - Intergenic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1109989560 13:70036669-70036691 TTGTTCATTTTCAATGAAGTAGG + Intronic
1109990906 13:70056244-70056266 AAGTTCATTATAAATGATGACGG + Intronic
1110735832 13:78935529-78935551 ATGTTCCTCATCAAAGAATAAGG - Intergenic
1111759504 13:92443894-92443916 ATGTTCTTGATCATTGTTGAGGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1117620633 14:57582634-57582656 ATGTTCATGAACAATCGAGTGGG - Intronic
1119046591 14:71323142-71323164 AAGTTCCTAAACAATGAAGATGG - Intronic
1122107147 14:99466799-99466821 AAGATCATGACCAAGGAAGATGG + Intronic
1124463861 15:29918843-29918865 AAGATAATAATCAATGAAGATGG + Intronic
1127394536 15:58533650-58533672 ATGATAATGATAAGTGAAGAAGG + Intronic
1131184598 15:90263991-90264013 CTGTTCATTGTCAATGAAGAAGG + Exonic
1131718310 15:95138065-95138087 ATGTTCACTGTCAATGTAGATGG + Intergenic
1133986113 16:10669530-10669552 ATGGTCAGAAGCAATGAAGAAGG + Intronic
1134788533 16:16966988-16967010 AAGTTCTTCATCAATGCAGACGG - Intergenic
1135059579 16:19259629-19259651 ATGTACAAAATCCATGAAGAGGG - Intronic
1137034210 16:35555378-35555400 TTGTTCATGCTCTATGAAAAAGG + Intergenic
1139993922 16:70962586-70962608 ATGGTCATGATAAATTAAAAGGG - Intronic
1146949527 17:36896268-36896290 ACGTTTAGGTTCAATGAAGAAGG + Intergenic
1147548176 17:41419313-41419335 ATGTACATGAACAAGGAATATGG + Intergenic
1148572485 17:48681253-48681275 ATGTTCCAGATCTATGAGGAGGG - Intergenic
1149700601 17:58652093-58652115 ATCTTCATTATTAATGAAGGTGG - Intronic
1153173285 18:2340806-2340828 AAGTTCATGATAAATGAATTAGG - Intergenic
1153672122 18:7421406-7421428 ATGTTCATCCTAAATGAAAAAGG - Intergenic
1153737933 18:8092074-8092096 ATTTTCAACATCAATGAATACGG - Intronic
1155720981 18:29011701-29011723 ATGTACATGAACAAAGAAAAGGG + Intergenic
1155858868 18:30870847-30870869 ATGATAATGATAAATTAAGATGG - Intergenic
1159484015 18:69029781-69029803 ATGATTATGTTCAAAGAAGAAGG + Intronic
1159741010 18:72170430-72170452 ATGTACATTTTCAATGAAAAAGG + Intergenic
1161898198 19:7098692-7098714 AAATTCCTGATCAATGAAAAAGG - Intergenic
1167700205 19:51038984-51039006 ATTTTGAGGTTCAATGAAGAAGG - Intergenic
925084975 2:1100847-1100869 ATGTTTATGGTCAATTCAGAAGG + Intronic
925815354 2:7742346-7742368 ATGCCCTTCATCAATGAAGAAGG + Intergenic
926505045 2:13703642-13703664 ATGTTCATTATCTATGGAAAGGG + Intergenic
929633226 2:43487980-43488002 ATGTAAATGATTAATGCAGAAGG - Intronic
930195026 2:48500966-48500988 ATGTTCATGACCAATGGTCATGG + Intronic
930863587 2:56100835-56100857 TTTTTCATAATCATTGAAGAAGG - Intergenic
931261856 2:60626975-60626997 ATTTACCTGATGAATGAAGAGGG + Intergenic
932143505 2:69299406-69299428 ATGCTAATTAACAATGAAGACGG - Intergenic
932786379 2:74607862-74607884 ATGTTTTTGATCCATGAAGAGGG + Intronic
932897198 2:75651624-75651646 ATCTTCCTGATCAGAGAAGATGG - Intronic
932920152 2:75904095-75904117 ATGTTCTAGAGCATTGAAGAAGG + Intergenic
934544096 2:95200186-95200208 CTGTTCATCATCATGGAAGAGGG - Intergenic
935813794 2:106827324-106827346 ATGATCAAGATCAAAGAAGAGGG + Intronic
936753423 2:115675321-115675343 ATGTTCATGACCAATATAAATGG + Intronic
937484470 2:122300186-122300208 ATGTTAATAATTGATGAAGATGG - Intergenic
939086611 2:137726816-137726838 ATATTCATGATCAAGGATCAGGG - Intergenic
939640215 2:144631612-144631634 ATGATTAAGCTCAATGAAGAAGG + Intergenic
940433603 2:153624028-153624050 ATTTTCTTTAACAATGAAGATGG + Intergenic
941159541 2:162020618-162020640 AAGATCATCAGCAATGAAGAAGG - Exonic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
943601707 2:189929378-189929400 ATGTTTATGAAAAATGAAGGTGG - Intronic
946547792 2:220764517-220764539 ATGTTCATGATTAAGGAAAGAGG - Intergenic
947451919 2:230216643-230216665 ATGTTCATTATCACAGAAGGTGG - Intronic
1170853064 20:20021289-20021311 ATCTTCATGATGTATTAAGAAGG + Intronic
1173175073 20:40758762-40758784 GTGTTATTGATAAATGAAGATGG - Intergenic
1175622661 20:60463201-60463223 ATGTTCATGATATAGGAAGGGGG - Intergenic
1175757034 20:61536422-61536444 ATGTTCATGATTACTAAGGAGGG + Intronic
1177259344 21:18709160-18709182 ATATTTATGATCTCTGAAGATGG + Intergenic
1177657122 21:24032255-24032277 ATCTTCATGTTAAAAGAAGAAGG + Intergenic
1178501707 21:33131050-33131072 AGGTTTCTCATCAATGAAGAAGG - Intergenic
1182799000 22:33014961-33014983 ATTTACATGATAAATGAAAATGG + Intronic
1183903896 22:41025497-41025519 ATGTTGATAATCACTGAAGCTGG - Intergenic
949219656 3:1616671-1616693 ATGTTCATGATCATTTGAAATGG - Intergenic
949476261 3:4448781-4448803 ATGTTCATGAAAAATGGAGGTGG - Intronic
949699282 3:6737479-6737501 CTGTTCATGCTCAAGGAATAGGG - Intergenic
951375868 3:21916079-21916101 ATATTCATGAACATTTAAGAAGG - Intronic
951461656 3:22957659-22957681 TTGTTCATGTTAAAGGAAGAGGG + Intergenic
952097677 3:29973226-29973248 ATGTTAAGGAACACTGAAGAGGG + Intronic
953410201 3:42686576-42686598 ATCTTCATGATCAGTGAGGAGGG + Exonic
953592592 3:44273971-44273993 ATTTTCATCATCAAAGAAAATGG - Intronic
953781386 3:45874128-45874150 ATATTAATGAAGAATGAAGATGG - Intronic
954734367 3:52693080-52693102 ATGCTTATGATGAAAGAAGATGG - Intronic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
955779979 3:62474116-62474138 TTCTACATGATCAATGAAGAGGG + Intronic
956944998 3:74210909-74210931 ATGTTAATGAACCATGAAGGAGG - Intergenic
958724594 3:97889143-97889165 GTGTTCCTCATCAATGTAGATGG - Intronic
959660100 3:108858653-108858675 ATGTTCTTAATCAATGCAGATGG - Intergenic
961159568 3:124711842-124711864 TTGTTCATGATTATTGAAGTTGG + Intronic
962556734 3:136560576-136560598 ATATTCAGTATCAATGAAGTGGG - Intronic
964407636 3:156366140-156366162 ATTTTCATGACTACTGAAGATGG + Intronic
964696685 3:159516081-159516103 ATGTTTAAGATCCAGGAAGAAGG - Intronic
966443753 3:179976868-179976890 ATGTTTATAATTCATGAAGAAGG + Intronic
971130134 4:23799153-23799175 ATGTGCATGAACACTGAATATGG + Intronic
972113080 4:35590853-35590875 ATGTCCTTGATGAATGAATAGGG - Intergenic
976473216 4:85453786-85453808 ATGTATCTGATAAATGAAGATGG - Intergenic
978704373 4:111689028-111689050 ATGTTCAACATAAATGCAGATGG + Intergenic
980474381 4:133293071-133293093 ATGTTTATAATAAATGAAAATGG - Intergenic
984443843 4:179808085-179808107 ATGCTTCTGATCAATGAATATGG - Intergenic
984621613 4:181959416-181959438 ATGTTCATTATGTGTGAAGAAGG + Intergenic
984919215 4:184749246-184749268 ATTTTCATAATAAAAGAAGAGGG + Intergenic
985331967 4:188847417-188847439 ATCTTCATAATAAATGGAGATGG - Intergenic
986802560 5:11277319-11277341 ATTCACATCATCAATGAAGATGG + Intronic
986892987 5:12331674-12331696 ATGTTCATCATCATTGATCAGGG + Intergenic
987012361 5:13780658-13780680 ATGTTTATGATCTATGACAAAGG + Intronic
987698958 5:21370031-21370053 ATGTTCTTTATCAAAGGAGAAGG - Intergenic
987772672 5:22326771-22326793 ATGATCATTATCAGTGAAAATGG - Intronic
988753694 5:34221440-34221462 ATGTTCTTTATCAAAGGAGAAGG + Intergenic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
991741479 5:69682295-69682317 ATGTTCTTTATCAAAGGAGAAGG + Intergenic
991756139 5:69872144-69872166 ATGTTCTTTATCAAAGGAGAAGG - Intergenic
991793053 5:70262033-70262055 ATGTTCTTTATCAAAGGAGAAGG + Intergenic
991820938 5:70558369-70558391 ATGTTCTTTATCAAAGGAGAAGG + Intergenic
991835542 5:70748061-70748083 ATGTTCTTTATCAAAGGAGAAGG - Intergenic
991885502 5:71262338-71262360 ATGTTCTTTATCAAAGGAGAAGG + Intergenic
993199981 5:84803457-84803479 ATAATCATGAACAATGAAGATGG + Intergenic
993485397 5:88478110-88478132 ATTTACATGATTTATGAAGAAGG - Intergenic
994543948 5:101139026-101139048 AAGTTCATGCTCAATAAATATGG + Intergenic
995173313 5:109143086-109143108 ATGTTCCTGTTTAATTAAGAAGG + Intronic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
997781674 5:136665890-136665912 ATGTTCATGTTCTATTAAGTGGG - Intergenic
998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG + Intergenic
998725721 5:145011619-145011641 ATGATGATGACCAAGGAAGAAGG - Intergenic
999884176 5:155901864-155901886 CTGTTCTTGATCTATGAAGTGGG - Intronic
1000218259 5:159185918-159185940 ATGTACAAGATCTATGAAAAGGG + Intronic
1000576568 5:162982358-162982380 ATGTTGAATATCAATGGAGAAGG - Intergenic
1000585152 5:163088227-163088249 ATGTGCATGATAAAAGAACAAGG - Intergenic
1003322014 6:5060080-5060102 ATGTACATGCTCATTAAAGAGGG - Intergenic
1005551862 6:26928272-26928294 ATGTTCTTTATCAAAGGAGAAGG + Intergenic
1005559890 6:27028362-27028384 GTGTTCATGTTCCATGAACATGG + Intergenic
1007081098 6:39104852-39104874 ATGGTGATGGGCAATGAAGAGGG + Exonic
1008172833 6:48231227-48231249 ATGTTAATCATCATTGAAGCTGG - Intergenic
1010189826 6:73183689-73183711 ATTTTCATGATCAAAATAGAAGG - Intronic
1010499134 6:76573237-76573259 ATTTTCATGATCTCTGAAGCAGG - Intergenic
1010703725 6:79081899-79081921 ATATTCATGCTCTATGAAGAAGG - Intergenic
1012051589 6:94352032-94352054 ATGCTCATTTTCAAAGAAGAAGG - Intergenic
1013351972 6:109314021-109314043 TGGTCCATGATCAATAAAGAAGG + Intergenic
1013412160 6:109892031-109892053 ATGTACATGATGTAAGAAGAAGG - Intergenic
1013568524 6:111395322-111395344 ATGTTTCTGATCCATGAACATGG + Intronic
1014489767 6:122047241-122047263 ATGTTTATGTGCAATGAAAAAGG - Intergenic
1016808365 6:148235993-148236015 ATATTCATAATGAATGAACAGGG - Intergenic
1017932089 6:158965065-158965087 ATGTTCAAGATCATTCAATAAGG - Intergenic
1020578166 7:9960597-9960619 CTGTTCATGATCATTAAAGAAGG - Intergenic
1021692087 7:23240540-23240562 ATATTGATGATCACTGAAGTAGG + Intronic
1023604601 7:41918039-41918061 ATTTTCATGATGATTGAAGACGG - Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1025479020 7:60959458-60959480 GTGTGCATCATGAATGAAGACGG - Intergenic
1027616811 7:80433908-80433930 ATTTTATTGACCAATGAAGATGG - Intronic
1028469411 7:91188288-91188310 ATGTTCATGATCAGTTATAAAGG - Intronic
1030120268 7:106103127-106103149 ATGTTCATGAAAAATGGGGAGGG + Intronic
1030340540 7:108374798-108374820 AGGCTCATGATCAATGATTAGGG + Intronic
1032714031 7:134488945-134488967 ATTTTAATGAGCAATGAACATGG + Intergenic
1034117665 7:148598486-148598508 ATTTTCATGATTAAGGAAGCAGG - Intronic
1034735160 7:153422154-153422176 ATCTTCATGAGCAATGGAAATGG + Intergenic
1038235009 8:25744830-25744852 ATGTTTATGATCAAGGAAAAAGG + Intergenic
1038547036 8:28433663-28433685 ATGTTTATCATTAATGAACAAGG - Intronic
1038895144 8:31774254-31774276 ATGTTGATCATAAATGAAGTAGG - Intronic
1041207464 8:55512963-55512985 ATGTTCATGATCACACAAGGTGG - Intronic
1041607335 8:59798031-59798053 AGGTTCTTAATCAATGGAGAAGG + Intergenic
1043186888 8:77163656-77163678 ATATTAATGATGAATAAAGAAGG - Intergenic
1046156132 8:110292206-110292228 ATGTTGATAAGCAATGCAGAAGG + Intergenic
1046650950 8:116836016-116836038 AACTTCATGATCAATGATGATGG - Intronic
1046710885 8:117510164-117510186 ATGTTCATCAGCAATGAATAAGG + Intergenic
1046866030 8:119151364-119151386 ATGTCCATGAGAAATGAATAAGG - Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051053983 9:12961753-12961775 ATGGTCCTGATCAATTAACAGGG + Intergenic
1051213589 9:14772427-14772449 ATGTTCATAACACATGAAGATGG + Intronic
1052143628 9:25021187-25021209 ATTTTCATGATCCATGAGCATGG + Intergenic
1052801134 9:32969394-32969416 ATGTTCATGACAAAGCAAGAGGG - Intergenic
1055624573 9:78162222-78162244 ATGTTCACGTTCCTTGAAGAGGG - Intergenic
1055772515 9:79732463-79732485 ATGTTCATGTTCAGTGGAGTAGG + Intergenic
1056521859 9:87409054-87409076 CTTTTCATGATCTCTGAAGATGG - Intergenic
1056974007 9:91233966-91233988 ATGGTCATGAACTAAGAAGACGG + Intronic
1060575513 9:124688915-124688937 ATCCTCACAATCAATGAAGAAGG + Intronic
1061432564 9:130540501-130540523 TTTTTCATGACAAATGAAGATGG - Intergenic
1187235941 X:17467189-17467211 ATGTTCCTAATTAATGAAGATGG + Intronic
1188192904 X:27194330-27194352 AGTTTCATTATCAATGTAGATGG - Intergenic
1188487125 X:30694212-30694234 ATGTTCATGAACAAAGATTAGGG - Intronic
1188947889 X:36330527-36330549 ATACTCATTATCAATGAAGATGG + Intronic
1190620153 X:52279184-52279206 ATTTTAATGAGCAATGAATATGG - Intergenic
1193240974 X:79168843-79168865 AGCTTCATTATCTATGAAGATGG - Intergenic
1194081827 X:89476931-89476953 ATTTTAATGATAAATGAATAAGG - Intergenic
1194234528 X:91365725-91365747 ATAGTCAAGATCAAAGAAGATGG - Intergenic
1195287556 X:103399870-103399892 ATGTTCATGAATAATAAATATGG - Intergenic
1196537067 X:116858842-116858864 ATGTTCCTGATGAATCTAGATGG - Intergenic
1196632770 X:117962476-117962498 ATGTGTGTAATCAATGAAGATGG + Intronic
1197296628 X:124727121-124727143 ATGCTAAAAATCAATGAAGATGG + Intronic
1200434495 Y:3133121-3133143 ATTTTAATGATAAATGAATAAGG - Intergenic
1200767168 Y:7089982-7090004 ATGTTCATGATCAAATATTAGGG + Intronic