ID: 1100107711

View in Genome Browser
Species Human (GRCh38)
Location 12:91197112-91197134
Sequence TTATTGATTAATAGGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100107709_1100107711 10 Left 1100107709 12:91197079-91197101 CCTTGTCATTTTTTATTAAAAAC No data
Right 1100107711 12:91197112-91197134 TTATTGATTAATAGGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100107711 Original CRISPR TTATTGATTAATAGGAATGA AGG Intergenic
No off target data available for this crispr