ID: 1100111600

View in Genome Browser
Species Human (GRCh38)
Location 12:91250468-91250490
Sequence TGGGACTCTTTGAGAACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100111596_1100111600 0 Left 1100111596 12:91250445-91250467 CCTTATTTTTCACATGATTGTCC No data
Right 1100111600 12:91250468-91250490 TGGGACTCTTTGAGAACATCTGG No data
1100111595_1100111600 8 Left 1100111595 12:91250437-91250459 CCTCATATCCTTATTTTTCACAT No data
Right 1100111600 12:91250468-91250490 TGGGACTCTTTGAGAACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100111600 Original CRISPR TGGGACTCTTTGAGAACATC TGG Intergenic
No off target data available for this crispr