ID: 1100114989

View in Genome Browser
Species Human (GRCh38)
Location 12:91293932-91293954
Sequence CATTTTCAACTGATGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100114988_1100114989 12 Left 1100114988 12:91293897-91293919 CCACTGAGAAGAATGAAAATCGT No data
Right 1100114989 12:91293932-91293954 CATTTTCAACTGATGTACCCAGG No data
1100114987_1100114989 13 Left 1100114987 12:91293896-91293918 CCCACTGAGAAGAATGAAAATCG No data
Right 1100114989 12:91293932-91293954 CATTTTCAACTGATGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100114989 Original CRISPR CATTTTCAACTGATGTACCC AGG Intergenic
No off target data available for this crispr