ID: 1100120586

View in Genome Browser
Species Human (GRCh38)
Location 12:91364888-91364910
Sequence CTACTGAAACAGACTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100120586_1100120592 10 Left 1100120586 12:91364888-91364910 CCTCCCTCAGTCTGTTTCAGTAG No data
Right 1100120592 12:91364921-91364943 AGAGTAATATAAAAAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100120586 Original CRISPR CTACTGAAACAGACTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr