ID: 1100120807

View in Genome Browser
Species Human (GRCh38)
Location 12:91367361-91367383
Sequence AGCATGGGTGGGTATAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100120807_1100120815 25 Left 1100120807 12:91367361-91367383 CCACCTCTATACCCACCCATGCT No data
Right 1100120815 12:91367409-91367431 CCAAAGTTTAGAGAGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100120807 Original CRISPR AGCATGGGTGGGTATAGAGG TGG (reversed) Intergenic
No off target data available for this crispr