ID: 1100122628 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:91386411-91386433 |
Sequence | GAGTAAAATCAGGTGGGGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1100122622_1100122628 | 25 | Left | 1100122622 | 12:91386363-91386385 | CCAAAACAGAAGAAACAGCATAC | No data | ||
Right | 1100122628 | 12:91386411-91386433 | GAGTAAAATCAGGTGGGGCATGG | No data | ||||
1100122623_1100122628 | -4 | Left | 1100122623 | 12:91386392-91386414 | CCATTGTGAAATAAAGTGAGAGT | No data | ||
Right | 1100122628 | 12:91386411-91386433 | GAGTAAAATCAGGTGGGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1100122628 | Original CRISPR | GAGTAAAATCAGGTGGGGCA TGG | Intergenic | ||
No off target data available for this crispr |