ID: 1100122628

View in Genome Browser
Species Human (GRCh38)
Location 12:91386411-91386433
Sequence GAGTAAAATCAGGTGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100122622_1100122628 25 Left 1100122622 12:91386363-91386385 CCAAAACAGAAGAAACAGCATAC No data
Right 1100122628 12:91386411-91386433 GAGTAAAATCAGGTGGGGCATGG No data
1100122623_1100122628 -4 Left 1100122623 12:91386392-91386414 CCATTGTGAAATAAAGTGAGAGT No data
Right 1100122628 12:91386411-91386433 GAGTAAAATCAGGTGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100122628 Original CRISPR GAGTAAAATCAGGTGGGGCA TGG Intergenic
No off target data available for this crispr