ID: 1100122825

View in Genome Browser
Species Human (GRCh38)
Location 12:91388613-91388635
Sequence CTGTACAAACACAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100122820_1100122825 15 Left 1100122820 12:91388575-91388597 CCTTAGTATGTGTATGACAGAAC No data
Right 1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100122825 Original CRISPR CTGTACAAACACAAGGAGGA AGG Intergenic
No off target data available for this crispr