ID: 1100128532

View in Genome Browser
Species Human (GRCh38)
Location 12:91460676-91460698
Sequence GATTCTACCCCCAGTGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100128532_1100128533 -3 Left 1100128532 12:91460676-91460698 CCTAAATCACTGGGGGTAGAATC No data
Right 1100128533 12:91460696-91460718 ATCTTTGCATCTCAGCTTCATGG No data
1100128532_1100128536 3 Left 1100128532 12:91460676-91460698 CCTAAATCACTGGGGGTAGAATC No data
Right 1100128536 12:91460702-91460724 GCATCTCAGCTTCATGGGGATGG No data
1100128532_1100128534 -2 Left 1100128532 12:91460676-91460698 CCTAAATCACTGGGGGTAGAATC No data
Right 1100128534 12:91460697-91460719 TCTTTGCATCTCAGCTTCATGGG No data
1100128532_1100128535 -1 Left 1100128532 12:91460676-91460698 CCTAAATCACTGGGGGTAGAATC No data
Right 1100128535 12:91460698-91460720 CTTTGCATCTCAGCTTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100128532 Original CRISPR GATTCTACCCCCAGTGATTT AGG (reversed) Intergenic
No off target data available for this crispr