ID: 1100133676

View in Genome Browser
Species Human (GRCh38)
Location 12:91527361-91527383
Sequence ACCCAAATTCTGTGATTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100133676_1100133678 -2 Left 1100133676 12:91527361-91527383 CCACTGAATCACAGAATTTGGGT No data
Right 1100133678 12:91527382-91527404 GTTATTTCTCCAAAACAGGATGG No data
1100133676_1100133677 -6 Left 1100133676 12:91527361-91527383 CCACTGAATCACAGAATTTGGGT No data
Right 1100133677 12:91527378-91527400 TTGGGTTATTTCTCCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100133676 Original CRISPR ACCCAAATTCTGTGATTCAG TGG (reversed) Intergenic
No off target data available for this crispr