ID: 1100136907

View in Genome Browser
Species Human (GRCh38)
Location 12:91564314-91564336
Sequence GGTTGTGTAAGTTAACATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100136904_1100136907 7 Left 1100136904 12:91564284-91564306 CCAATTTTCTGGTTTTGATAATT No data
Right 1100136907 12:91564314-91564336 GGTTGTGTAAGTTAACATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100136907 Original CRISPR GGTTGTGTAAGTTAACATAA GGG Intergenic
No off target data available for this crispr