ID: 1100140693

View in Genome Browser
Species Human (GRCh38)
Location 12:91615297-91615319
Sequence ATATATCAACATATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100140693_1100140696 19 Left 1100140693 12:91615297-91615319 CCATGTTCCATATGTTGATATAT No data
Right 1100140696 12:91615339-91615361 TTAACCATTTCATATATAAAGGG No data
1100140693_1100140695 18 Left 1100140693 12:91615297-91615319 CCATGTTCCATATGTTGATATAT No data
Right 1100140695 12:91615338-91615360 TTTAACCATTTCATATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100140693 Original CRISPR ATATATCAACATATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr