ID: 1100142375 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:91634224-91634246 |
| Sequence | CCACGGCGGGGTGGGGGTAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100142375_1100142396 | 26 | Left | 1100142375 | 12:91634224-91634246 | CCCCTACCCCCACCCCGCCGTGG | No data | ||
| Right | 1100142396 | 12:91634273-91634295 | GATCGCCGCCCCCTGCTCCAGGG | No data | ||||
| 1100142375_1100142395 | 25 | Left | 1100142375 | 12:91634224-91634246 | CCCCTACCCCCACCCCGCCGTGG | No data | ||
| Right | 1100142395 | 12:91634272-91634294 | GGATCGCCGCCCCCTGCTCCAGG | No data | ||||
| 1100142375_1100142389 | 4 | Left | 1100142375 | 12:91634224-91634246 | CCCCTACCCCCACCCCGCCGTGG | No data | ||
| Right | 1100142389 | 12:91634251-91634273 | CTGCGCGCCAGAGCCTCCCCAGG | 0: 1 1: 0 2: 2 3: 16 4: 371 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100142375 | Original CRISPR | CCACGGCGGGGTGGGGGTAG GGG (reversed) | Intergenic | ||