ID: 1100142386

View in Genome Browser
Species Human (GRCh38)
Location 12:91634238-91634260
Sequence TGGCGCGCAGGCGCCCACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100142386_1100142389 -10 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142386_1100142395 11 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142386_1100142396 12 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142396 12:91634273-91634295 GATCGCCGCCCCCTGCTCCAGGG No data
1100142386_1100142398 19 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100142386 Original CRISPR TGGCGCGCAGGCGCCCACGG CGG (reversed) Intergenic